Cenpx (NM_016665) Mouse Untagged Clone
CAT#: MC209476
Stra13 (untagged) - Mouse stimulated by retinoic acid 13 (Stra13), (10ug)
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Stra13 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209476 representing NM_016665
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGGGAAACAGTGGCTTCCGGAAGGAACTGGTGAGCAGACTACTCCATTTGCACTTCAGGGATTGCA AGACCAAAGTCAGCGGGGATGCACTGCAGCTCATGGCGGAGTTCCTGAGGATCTTCGTACTAGAGGCTGC TGTCCGTGGGGTCTGGCAGGCCCAGGCAGAAGACCTGGATGTTGTGGAAGTGGATCAGCTGGAGAAAGTG CTCCCTCAGCTGCTCCTGGACTTCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_016665 |
Insert Size | 237 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_016665.2, NP_057874.2 |
RefSeq Size | 655 bp |
RefSeq ORF | 237 bp |
Locus ID | 20892 |
UniProt ID | Q8C4X1 |
Gene Summary | DNA-binding component of the Fanconi anemia (FA) core complex. Required for the normal activation of the FA pathway, leading to monoubiquitination of the FANCI-FANCD2 complex in response to DNA damage, cellular resistance to DNA cross-linking drugs, and prevention of chromosomal breakage. In complex with CENPS (MHF heterodimer), crucial cofactor for FANCM in both binding and ATP-dependent remodeling of DNA. Stabilizes FANCM. In complex with CENPS and FANCM (but not other FANC proteins), rapidly recruited to blocked forks and promotes gene conversion at blocked replication forks. In complex with CENPS, CENPT and CENPW (CENP-T-W-S-X heterotetramer), involved in the formation of a functional kinetochore outer plate, which is essential for kinetochore-microtubule attachment and faithful mitotic progression. As a component of MHF and CENP-T-W-S-X complexes, binds DNA and bends it to form a nucleosome-like structure. DNA-binding function is fulfilled in the presence of CENPS, with the following preference for DNA substates: Holliday junction > double-stranded > splay arm > single-stranded. Does not bind DNA on its own.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG221165 | Stra13 (tGFP-tagged) - Mouse stimulated by retinoic acid 13 (Stra13), (10ug) |
CNY 3400.00 |
|
MR221165 | Stra13 (Myc-DDK-tagged) - Mouse stimulated by retinoic acid 13 (Stra13) |
CNY 1800.00 |
|
MR221165L3 | Lenti ORF clone of Stra13 (Myc-DDK-tagged) - Mouse stimulated by retinoic acid 13 (Stra13) |
CNY 4750.00 |
|
MR221165L4 | Lenti ORF clone of Stra13 (mGFP-tagged) - Mouse stimulated by retinoic acid 13 (Stra13) |
CNY 4750.00 |