Tmie (NM_146260) Mouse Untagged Clone
CAT#: MC209463
Tmie (untagged) - Mouse transmembrane inner ear (Tmie), (10ug)
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 5131400L21Rik; Mm.87012; sr |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209463 representing NM_146260
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCGGGAGGCAGCATGGCTCGGGGCGGCTCTGGGCGCTGGGCGGCGCCGCGCTGGGGGCTTGCCTGG CGGGTGTCGCCACGCAGCTGGTAGAGCCCAGCACCGCACCGCCAAAGCCCAAGCCGCCCCCACTGACCAA GGAGACTGTGGTGTTCTGGGACATGCGCCTGTGGCACGTGGTGGGCATCTTTTCGCTCTTCGTGTTGTCC ATCATCATCACGCTATGCTGTGTCTTCAACTGCCGGGTGCCACGGACGCGGAAGGAGATCGAGGCTCGGT ATCTACAGCGAAAGGCGGCCAAGATGTACACAGACAAGCTGGAGACTGTGCCTCCCCTTAATGAACTCAC AGAAATCCCTGGAGAGGACAAGAAGAAAAAGAAGAAGGACAGTGTGGACACAGTGGCTATCAAGGTAGAG GAGGACGAGAAGAATGAGGCGAAGAAGAAAGGAGAGAAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_146260 |
Insert Size | 462 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC138840, AAI38841 |
RefSeq Size | 1967 bp |
RefSeq ORF | 462 bp |
Locus ID | 20776 |
UniProt ID | Q8K467 |
Gene Summary | Unknown. The protein may play some role in a cellular membrane location. May reside within an internal membrane compartment and function in pathways such as those involved in protein and/or vesicle trafficking. Alternatively, the mature protein may be localized in the plasma membrane and serve as a site of interaction for other molecules through its highly charged C-terminal domain.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223273 | Tmie (tGFP-tagged) - Mouse transmembrane inner ear (Tmie), (10ug) |
CNY 2850.00 |
|
MR223273 | Tmie (Myc-DDK-tagged) - Mouse transmembrane inner ear (Tmie) |
CNY 1200.00 |
|
MR223273L3 | Lenti ORF clone of Tmie (Myc-DDK-tagged) - Mouse transmembrane inner ear (Tmie) |
CNY 4750.00 |
|
MR223273L4 | Lenti ORF clone of Tmie (mGFP-tagged) - Mouse transmembrane inner ear (Tmie) |
CNY 4750.00 |