Sox15 (NM_009235) Mouse Untagged Clone

CAT#: MC209432

Sox15 (untagged) - Mouse SRY-box containing gene 15 (Sox15), (10ug)



  "NM_009235" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209432 representing NM_009235
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGCTGACCAGCTCCTCACAAGCAGAGACTTGGAGCCTGCATCCTCGGGCTTCCACGGCCTCTTTGC
CTTTAGGACCCCAGGAGCAGGAGGCCGGCGGGAGCCCTGGAGCGTCTGGGGGACTTCCGCTGGAGAAGGT
GAAGCGGCCCATGAACGCCTTCATGGTGTGGAGCTCTGTTCAGCGCCGCCAGATGGCGCAGCAGAACCCC
AAGATGCACAACTCTGAGATCTCCAAGCGCTTGGGCGCTCAGTGGAAGCTGCTGGGCGATGAAGAGAAGC
GACCCTTCGTGGAGGAGGCTAAGCGTCTTCGTGCCCGCCACCTCCGCGACTATCCCGACTACAAGTACCG
ACCCCGGCGTAAGAGCAAAAACTCGAGCACCGGGTCTGTCCCCTTTAGCCAAGAAGGAGGTGGCCTGGCA
TGTGGTGGCTCACACTGGGGGCCAGGGTACACAACTACCCAAGGGAGCAGAGGCTTTGGGTACCAGCCCC
CCAACTATTCGACAGCCTACCTGCCTGGCAGTTACACCTCTTCCCACTGCAGACCGGAGGCCCCCTTACC
ATGCACCTTCCCTCAGAGTGATCCCAGGCTCCAGGGGGAGCTAAGACCCTCTTTCTCCCCTTACCTATCC
CCAGACTCTTCCACTCCATATAATACTTCCCTTGCTGGAGCCCCCATGCCAGTAACCCACCTTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009235
Insert Size 696 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_009235.2, NP_033261.1
RefSeq Size 1156 bp
RefSeq ORF 696 bp
Locus ID 20670
UniProt ID P43267
Gene Summary Transcription factor that binds to DNA at the 5'-AACAATG-3' consensus sequence (PubMed:10821863, PubMed:15863505, PubMed:16759287, PubMed:17363903). Acts as a transcriptional activator and repressor (PubMed:10821863, PubMed:15863505, PubMed:16759287). Binds synergistically with POU5F1 (OCT3/4) to gene promoters (PubMed:15863505). Binds to the FOXK1 promoter and recruits FHL3, resulting in transcriptional activation of FOXK1 which leads to myoblast proliferation (PubMed:17363903). Acts as an inhibitor of myoblast differentiation via transcriptional repression which leads to down-regulation of the muscle-specific genes MYOD and MYOG (PubMed:10821863). Involved in trophoblast giant cell differentiation via enhancement of HAND1 transcriptional activity (PubMed:16759287). Regulates transcription of HRC via binding to it proximal enhancer region (PubMed:15863505). Involved in skeletal muscle regeneration (PubMed:15367664, PubMed:17363903). Also plays a role in the development of myogenic precursor cells (PubMed:15367664).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...