Cox7a2l (NM_009187) Mouse Untagged Clone
CAT#: MC209403
Cox7a2l (untagged) - Mouse cytochrome c oxidase subunit VIIa polypeptide 2-like (Cox7a2l), nuclear gene encoding mitochondrial protein, transcript variant 2, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | COX7AR; COX7RP; EB1; SIG-81; SIG81; Silg81 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209403 representing NM_009187
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTACTACAAGTTTAGCAGTTTCACGCAGAAGTTGGCTGGAGCTTGGGCTTCGGAAGCCTACACCCCGC AGGGGTTAAAGCCAGTTTCCACAGAAGCACCACCTATCATATTTGCCACACCAACCAAACTGACCTCCAG TGTGACAGCATATGATTATTCTGGGAAGAACAAAGTTCCAGAGCTGCAGAAGTTTTTCCAGAAGGCTGAT GGTTTCCACCTGAAACGAGGCCTTCCAGACCAAATGCTTTACCGGACCACCATGGCTCTGACACTGGGAG GGACCATCTACTGCCTGATCGCCCTCTACATGGCCTCGCAGCCCAGAAACAAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_009187 |
Insert Size | 336 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_009187.3, NP_033213.1 |
RefSeq Size | 1100 bp |
RefSeq ORF | 336 bp |
Locus ID | 20463 |
UniProt ID | Q61387 |
Gene Summary | Involved in the regulation of oxidative phosphorylation and energy metabolism (PubMed:23857330, PubMed:23812712). Necessary for the assembly of mitochondrial respiratory supercomplex (PubMed:23857330, PubMed:23812712).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG224086 | Cox7a2l (tGFP-tagged) - Mouse cytochrome c oxidase subunit VIIa polypeptide 2-like (Cox7a2l) nuclear gene encoding mitochondrial protein transcript variant 2, (10ug) |
CNY 2090.00 |
|
MR224086 | Cox7a2l (Myc-DDK-tagged) - Mouse cytochrome c oxidase subunit VIIa polypeptide 2-like (Cox7a2l), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 1900.00 |
|
MR224086L3 | Lenti ORF clone of Cox7a2l (Myc-DDK-tagged) - Mouse cytochrome c oxidase subunit VIIa polypeptide 2-like (Cox7a2l), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 3800.00 |
|
MR224086L4 | Lenti ORF clone of Cox7a2l (mGFP-tagged) - Mouse cytochrome c oxidase subunit VIIa polypeptide 2-like (Cox7a2l), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 3800.00 |
其它Cox7a2l产品