Ccl25 (NM_009138) Mouse Untagged Clone
CAT#: MC209363
Ccl25 (untagged) - Mouse chemokine (C-C motif) ligand 25 (Ccl25), transcript variant 1, (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | A130072A22Rik; AI852536; CKb15; Scya25; TECK |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209363 representing NM_009138
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAACTGTGGCTTTTTGCCTGCCTGGTTGCCTGTTTTGTTGGGGCCTGGATGCCGGTTGTCCATGCCC AAGGTGCCTTTGAAGACTGCTGCCTGGGTTACCAGCACAGGATCAAATGGAATGTTCTCCGGCATGCTAG GAATTATCACCAGCAGGAAGTGAGTGGAAGCTGCAACCTACGTGCTGTGAGATTCTACTTCCGCCAGAAA GTAGTGTGTGGGAATCCAGAGGACATGAATGTGAAGAGGGCGATGAGAATCTTGACAGCTAGGAAAAGGC TAGTCCACTGGAAGAGCGCCTCAGACTCTCAGACTGAAAGGAAGAAGTCAAACCATATGAAGTCCAAGGT GGAGAACCCCAACAGTACAAGCGTGAGGAGTGCCACCCTAGGTCATCCCAGGATGGTGATGATGCCCAGA AAGACCAACAATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_009138 |
| Insert Size | 435 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_009138.3, NP_033164.1 |
| RefSeq Size | 1073 bp |
| RefSeq ORF | 435 bp |
| Locus ID | 20300 |
| UniProt ID | O35903 |
| Gene Summary | Potentially involved in T-cell development. Recombinant protein shows chemotactic activity on thymocytes, macrophages, THP-1 cells, and dendritics cells but is inactive on peripheral blood lymphocytes and neutrophils. Binds to CCR9. Binds to atypical chemokine receptor ACKR4 and mediates the recruitment of beta-arrestin (ARRB1/2) to ACKR4.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the functional protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG222187 | Ccl25 (tGFP-tagged) - Mouse chemokine (C-C motif) ligand 25 (Ccl25) transcript variant 1, (10ug) |
CNY 2850.00 |
|
| MR222187 | Ccl25 (Myc-DDK-tagged) - Mouse chemokine (C-C motif) ligand 25 (Ccl25), transcript variant 1 |
CNY 1200.00 |
|
| MR222187L3 | Lenti ORF clone of Ccl25 (Myc-DDK-tagged) - Mouse chemokine (C-C motif) ligand 25 (Ccl25), transcript variant 1 |
CNY 4750.00 |
|
| MR222187L4 | Lenti ORF clone of Ccl25 (mGFP-tagged) - Mouse chemokine (C-C motif) ligand 25 (Ccl25), transcript variant 1 |
CNY 4750.00 |
