Rp1 (NM_001195662) Mouse Untagged Clone

CAT#: MC209321

Rp1 (untagged) - Mouse retinitis pigmentosa 1 (human) (Rp1), transcript variant 2, (10ug)



  "NM_001195662" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Dcdc3; Gm38717; mG145; O; Orp1; Rp; Rp1h
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209321 representing NM_001195662
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTTGAGAAATTGCAGGTCTCACCCAAAATGAGTGACACACCTTCTACTAGTTTCTCCATGATTCATC
TGACTTCTGAAGGTCAAGTTCCTTCCCCTCGCCATTCAAATATCACTCATCCTGTAGTGGCTAAACGCAT
CAGTTTCTATAAGAGTGGAGACCCACAGTTTGGCGGCGTTCGGGTGGTGGTCAACCCTCGTTCCTTTAAG
ACTTTTGACGCTCTGCTGGACAGTTTATCCAGGAAGGTACCCCTGCCCTTTGGGGTAAGGAACATCAGCA
CGCCCCGTGGACGACACAGCATCACCAGGCTGGAGGAGCTAGAGGACGGCAAGTCTTATGTGTGCTCCCA
CAATAAGAAGGTGCTGCCAGTTGACCTGGACAAGGCCCGCAGGCGCCCTCGGCCCTGGCTGAGTAGTCGC
TCCATAAGCACGCATGTGCAGCTCTGTCCTGCAACTGCCAATATGTCCACCATGGCACCTGGCATGCTCC
GTGCCCCAAGGAGGCTCGTGGTCTTCCGGAATGGTGACCCGAAGAATAAGCATGTGGTCCTTCTTAGCCG
GAGGATCACTCAGAGCTTCGAAGCCTTTCTGCAGTACCTGACACAGGTTATGCAGTGTCCTGTGGCCAAG
CTGTATGCCACAGATGGAAGAAAAGTTCCTAGTCTCCAGGCAGTGATACTCAGCTCTGGAGCTGTGGTGG
CAGCTGGAAGGGAGCCATTTAAACCAGGAAATTACGACATACAAAAGTACTTGCTTCCTGCCAAGTTACC
AGGAATCTCTCATCGTGTGCACCAGAAGGGAAAAGCCAAGATAGAAAAAAGAAAGAATTATGGTTGGGGA
CATAGGAACGCCGTTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001195662
Insert Size 858 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001195662.1, NP_001182591.1
RefSeq Size 3047 bp
RefSeq ORF 858 bp
Locus ID 19888
Gene Summary This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. [provided by RefSeq, Jun 2019]
Transcript Variant: This variant (2) has an alternate 5' exon, which results in an upstream in-frame AUG start codon, and an alternate 3' exon, as compared to variant 1. The resulting isoform (2) has a longer N-terminus, but has a much shorter and distinct C-terminus, as compared to isoform 1. The isoform 2 retains two doublecortin domains.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...