Rbbp6 (NM_175023) Mouse Untagged Clone

CAT#: MC209298

Rbbp6 (untagged) - Mouse retinoblastoma binding protein 6 (Rbbp6), transcript variant 2, (10ug)



  "NM_175023" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 4933422O15Rik; AI316869; BB233631; C030034J04Rik; C77662; P2P-R; PACT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209298 representing NM_175023
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCTGTGTGCACTATAAATTTTCCTCTAAACTCAACTACGACACCGTCACTTTTGATGGGCTCCATA
TCTCCCTCTGCGATTTAAAGAAGCAGATTATGGGGAGAGAAAAGCTGAAAGCTGCCGATAGCGATCTGCA
GATCACCAACGCACAGACGAAAGAAGAATACACTGATGACAATGCGCTCATTCCTAAGAACTCATCTGTG
ATTGTCAGGAGGATTCCTATTGGAGGTGTCAAGTCTACAAGCAAGACATATGTTATAAGTCGAACTGAAC
CAGTGATGGGAACTACAAAAGCAGTATGTAAAAACACAATCACCCTTTTTCTACACAATTGCTTTTACCT
TTATAATGTTTCAGTGACGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_175023
Insert Size 372 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_175023.3, NP_778188.1
RefSeq Size 2272 bp
RefSeq ORF 372 bp
Locus ID 19647
UniProt ID P97868
Gene Summary E3 ubiquitin-protein ligase which promotes ubiquitination of YBX1, leading to its degradation by the proteasome (By similarity). May play a role as a scaffold protein to promote the assembly of the p53/TP53-MDM2 complex, resulting in increase of MDM2-mediated ubiquitination and degradation of p53/TP53; may function as negative regulator of p53/TP53, leading to both apoptosis and cell growth retardation (PubMed:17470788). Regulates DNA-replication and common fragile sites (CFS) stability in a ZBTB38- and MCM10-dependent manner. Controls ZBTB38 protein stability and abundance via ubiquitination and proteasomal degradation, and ZBTB38 in turn negatively regulates the expression of MCM10 which plays an important role in DNA-replication (PubMed:24726359).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks most 3' exons and has an alternate 3' segment, as compared to variant 1. The resulting isoform 2 is much shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...