Pspn (NM_008954) Mouse Untagged Clone
CAT#: MC209248
Pspn (untagged) - Mouse persephin (Pspn), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | PSP |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209248 representing NM_008954
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTGCAGGAAGACTTCGGATCCTGTGTCTGCTGCTCCTGTCCTTGCACCCGAGCCTCGGCTGGGTCC TTGATCTTCAAGAGGCTTCTGTGGCAGATAAGCTCTCATTTGGGAAGATGGCAGAGACTAGAGGGACCTG GACGCCCCATCAGGGTAACAACCATGTCCGTCTTCCAAGAGCCTTGGCTGGTTCATGCCGACTGTGGAGC CTGACCCTACCAGTGGCTGAGCTGGGCCTGGGCTATGCCTCGGAGGAGAAGGTCATCTTCCGATACTGTG CTGGCAGCTGTCCCCAAGAGGCCCATACCCAGCACAGTCTGGTACTGGCCCGGCTTCGAGGGCGGGGTCG AGCCCATGGCCGACCCTGCTGCCAGCCCACCAGCTATGCTGATGTGACCTTCCTTGATGATCAGCACCAT TGGCAGCAGCTGCCTCAGCTCTCAGCTGCAGCTTGTGGCTGTGGTGGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_008954 |
| Insert Size | 471 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_008954.2, NP_032980.2 |
| RefSeq Size | 474 bp |
| RefSeq ORF | 471 bp |
| Locus ID | 19197 |
| Gene Summary | This gene encodes a secreted ligand of the GDNF (glial cell line-derived neurotrophic factor) subfamily and TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein signals through the RET receptor tyrosine kinase and a GPI-linked coreceptor, and promotes survival of neuronal populations. This protein may play a role in cell death, and nervous system development and function. Mice lacking a functional copy of this gene exhibit hypersensitivity to cerebral ischemia. [provided by RefSeq, Aug 2016] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG215304 | Pspn (tGFP-tagged) - Mouse persephin (Pspn), (10ug) |
CNY 2850.00 |
|
| MR215304 | Pspn (Myc-DDK-tagged) - Mouse persephin (Pspn) |
CNY 1200.00 |
|
| MR215304L3 | Lenti ORF clone of Pspn (Myc-DDK-tagged) - Mouse persephin (Pspn) |
CNY 4750.00 |
|
| MR215304L4 | Lenti ORF clone of Pspn (mGFP-tagged) - Mouse persephin (Pspn) |
CNY 4750.00 |
