Pomc (NM_008895) Mouse Untagged Clone
CAT#: MC209201
Pomc (untagged) - Mouse pro-opiomelanocortin-alpha (Pomc), (10ug)
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | ACT; ACTH; alp; alph; alpha-MSH; alphaMSH; BE; Beta-LPH; beta-M; beta-MSH; Clip; gamma-; Gamma-LPH; gamma-MSH; Npp; PO; Pomc-1; Pomc1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209201 representing NM_008895
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCGAGATTCTGCTACAGTCGCTCAGGGGCCCTGTTGCTGGCCCTCCTGCTTCAGACCTCCATAGATG TGTGGAGCTGGTGCCTGGAGAGCAGCCAGTGCCAGGACCTCACCACGGAGAGCAACCTGCTGGCTTGCAT CCGGGCTTGCAAACTCGACCTCTCGCTGGAGACGCCCGTGTTTCCTGGCAACGGAGATGAACAGCCCCTG ACTGAAAACCCCCGGAAGTACGTCATGGGTCACTTCCGCTGGGACCGCTTCGGCCCCAGGAACAGCAGCA GTGCTGGCAGCGCGGCGCAGAGGCGTGCGGAGGAAGAGGCGGTGTGGGGAGATGGCAGTCCAGAGCCGAG TCCACGCGAGGGCAAGCGCTCCTACTCCATGGAGCACTTCCGCTGGGGCAAGCCGGTGGGCAAGAAACGG CGCCCGGTGAAGGTGTACCCCAACGTTGCTGAGAACGAGTCGGCGGAGGCCTTTCCCCTAGAGTTCAAGA GGGAGCTGGAAGGCGAGCGGCCATTAGGCTTGGAGCAGGTCCTGGAGTCCGACGCGGAGAAGGACGACGG GCCCTACCGGGTGGAGCACTTCCGCTGGAGCAACCCGCCCAAGGACAAGCGTTACGGTGGCTTCATGACC TCCGAGAAGAGCCAGACGCCCCTGGTGACGCTCTTCAAGAACGCCATCATCAAGAACGCGCACAAGAAGG GCCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_008895 |
| Insert Size | 708 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC061215, AAH61215 |
| RefSeq Size | 1070 bp |
| RefSeq ORF | 708 bp |
| Locus ID | 18976 |
| UniProt ID | P01193 |
| Gene Summary | This gene encodes a polypeptide hormone precursor that undergoes extensive, tissue-specific, post-translational processing. Processing yields several biologically active peptides, which are involved in diverse cellular functions, such as energy homeostasis, steroidogenesis, and increased melanin production in melanocytes. In mouse deficiency of this gene is associated with obesity, defects in adrenal development, and altered pigmentation. A pseudogene of this gene is located on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013] Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, and 5 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG202856 | Pomc (tGFP-tagged) - Mouse pro-opiomelanocortin-alpha (Pomc1) |
CNY 2850.00 |
|
| MR202856 | Pomc (Myc-DDK-tagged) - Mouse pro-opiomelanocortin-alpha (Pomc) |
CNY 2400.00 |
|
| MR202856L3 | Lenti ORF clone of Pomc (Myc-DDK-tagged) - Mouse pro-opiomelanocortin-alpha (Pomc) |
CNY 4750.00 |
|
| MR202856L4 | Lenti ORF clone of Pomc (mGFP-tagged) - Mouse pro-opiomelanocortin-alpha (Pomc) |
CNY 4750.00 |
