Pa2g4 (NM_011119) Mouse Untagged Clone

CAT#: MC209189

Pa2g4 (untagged) - Mouse proliferation-associated 2G4 (Pa2g4), (10ug)



  "NM_011119" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
Pa2g4 Antibody - C-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 38kDa; AA672939; Ebp1; Plfap
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209189 representing NM_011119
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGGGCGAAGACGAGCAGCAGGAGCAAACTATCGCCGAGGACCTGGTCGTGACCAAGTATAAGATGG
GGGGCGACATCGCCAACCGGGTGCTTCGATCTTTGGTGGAGGCTTCCAGCTCAGGTGTGTCTGTGCTGAG
CTTGTGTGAGAAAGGTGATGCCATGATTATGGAAGAGACAGGGAAGATCTTCAAGAAGGAAAAGGAGATG
AAGAAAGGTATTGCCTTTCCTACCAGCATTTCCGTAAATAACTGTGTGTGTCACTTCTCCCCTTTGAAGA
GTGACCAGGACTATATACTCAAGGAAGGTGACTTGGTAAAAATTGACCTTGGGGTTCATGTGGATGGCTT
CATTGCCAATGTGGCTCACACTTTTGTAATTGGTGTAGCTCAGGGGACCCAGGTAACAGGGCGGAAAGCA
GATGTCATTAAGGCCGCTCACCTATGTGCTGAAGCTGCCTTACGACTGGTCAAACCTGGAAACCAGAACA
CACAAGTGACTGAAGCATGGAACAAGGTTGCTCACTCATTTAACTGCACACCAATAGAAGGTATGCTGTC
ACACCAATTGAAGCAGCATGTGATTGATGGAGAGAAGACGATTATCCAGAACCCTACAGACCAGCAGAAG
AAGGACCATGAAAAGGCAGAATTTGAGGTGCATGAGGTTTATGCTGTAGATGTCCTCGTCAGCTCAGGAG
AAGGCAAGGCCAAAGATGCAGGACAGAGAACCACCATCTACAAGCGAGACCCCTCTAAACAATATGGCCT
GAAAATGAAAACTTCACGTGCCTTTTTCAGTGAGGTGGAACGGCGTTTTGATGCCATGCCGTTTACTTTA
AGAGCATTTGAAGATGAGAAGAAGGCTCGAATGGGTGTGGTAGAGTGTGCCAAACATGAGTTACTACAGC
CATTTAACGTTCTCTATGAGAAGGAGGGTGAATTTGTTGCCCAGTTTAAATTTACAGTTCTACTCATGCC
CAACGGCCCCATGCGGATAACCAGTGGTCCCTTTGAGCCTGACCTGTACAAGTCTGAGATGGAGGTTCAA
GATGCAGAGCTGAAGGCTCTTCTCCAGAGTTCTGCAAGTAGAAAAACCCAGAAAAAGAAGAAAAAGAAGG
CCTCCAAGACTGTAGAGAATGCCACCAGTGGAGAAACCTTAGAAGAGAATGGAGCTGGGGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011119
Insert Size 1185 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_011119.3, NP_035249.1
RefSeq Size 2432 bp
RefSeq ORF 1185 bp
Locus ID 18813
UniProt ID P50580
Gene Summary May play a role in a ERBB3-regulated signal transduction pathway. Seems be involved in growth regulation. Acts a corepressor of the androgen receptor (AR) and is regulated by the ERBB3 ligand neuregulin-1/heregulin (HRG). Inhibits transcription of some E2F1-regulated promoters, probably by recruiting histone acetylase (HAT) activity. Binds RNA. Associates with 28S, 18S and 5.8S mature rRNAs, several rRNA precursors and probably U3 small nucleolar RNA. May be involved in regulation of intermediate and late steps of rRNA processing. May be involved in ribosome assembly (By similarity). Mediates cap-independent translation of specific viral IRESs (internal ribosomal entry site). Together with PTBP1 is required for the translation initiation on the foot-and-mouth disease virus (FMDV) IRES. Regulates cell proliferation, differentiation, and survival. Isoform 1 suppresses apoptosis whereas isoform 2 promotes cell differentiation (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...