Prkacb (NM_001164198) Mouse Untagged Clone

CAT#: MC209174

Prkacb (untagged) - Mouse protein kinase, cAMP dependent, catalytic, beta (Prkacb), transcript variant 2, (10ug)



  "NM_001164198" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
PRKACB Antibody - C-terminal region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms CbPKA; Pkacb
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209174 representing NM_001164198
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAATGTGAAAGAGTTTCTAGCCAAAGCCAAAGAAGACTTTCTGAGGAAATGGGAGAACCCTCCCCCGA
GTAATGCTGGGCTTGAGGATTTTGAGAGGAAGAAAACCCTCGGGACGGGTTCCTTTGGAAGAGTCATGTT
GGTGAAGCATAAAGCCACTGAGCAGTACTACGCCATGAAGATCTTAGACAAGCAGAAGGTTGTTAAGCTG
AAGCAAATAGAGCACACTCTGAATGAGAAGAGAATCCTGCAGGCCGTGGAGTTCCCGTTCCTTGTGCGGC
TGGAGTACTCTTTTAAGGATAATTCTAATTTATACATGGTTATGGAATACGTCCCTGGGGGAGAGATGTT
CTCACATCTGAGAAGAATTGGAAGGTTCAGTGAGCCCCACGCCCGTTTCTATGCAGCCCAGATTGTGCTA
ACATTTGAGTACCTTCATTCCCTCGACCTCATCTACAGAGATCTCAAGCCGGAAAACCTCTTAATTGACC
ACCAGGGTTACATCCAGGTCACAGATTTCGGGTTCGCCAAAAGAGTCAAGGGCAGGACATGGACATTGTG
TGGCACCCCAGAGTACCTGGCCCCGGAGATCATCCTCAGCAAGGGTTACAATAAGGCGGTGGACTGGTGG
GCACTGGGCGTGCTGATCTATGAGATGGCTGCTGGCTACCCTCCATTCTTTGCTGACCAGCCAATTCAGA
TCTATGAGAAGATTGTCTCTGGAAAGGTCCGGTTCCCATCACACTTCAGCTCCGATCTCAAGGACCTTCT
GCGGAACCTGCTGCAGGTGGATCTGACAAAGCGATTCGGGAACCTGAAGAACGGCGTGAGTGACATAAAG
ACCCACAAGTGGTTTGCCACAACTGACTGGATTGCTATTTATCAGAGAAAGGTTGAGGCTCCATTCATAC
CAAAGTTCAGAGGCTCTGGCGATACCAGCAACTTCGATGACTATGAAGAAGAAGAAATCCGTGTGTCTAT
AACAGAAAAATGTGGAAAGGAATTTTGTGAATTTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001164198
Insert Size 1017 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001164198.1, NP_001157670.1
RefSeq Size 4337 bp
RefSeq ORF 1017 bp
Locus ID 18749
UniProt ID P68181
Gene Summary Mediates cAMP-dependent signaling triggered by receptor binding to GPCRs. PKA activation regulates diverse cellular processes such as cell proliferation, the cell cycle, differentiation and regulation of microtubule dynamics, chromatin condensation and decondensation, nuclear envelope disassembly and reassembly, as well as regulation of intracellular transport mechanisms and ion flux (PubMed:9368018). Regulates the abundance of compartmentalized pools of its regulatory subunits through phosphorylation of PJA2 which binds and ubiquitinates these subunits, leading to their subsequent proteolysis. Phosphorylates GPKOW which regulates its ability to bind RNA (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternative exon at the 5' end compared to variant 1. The resulting isoform (2) has a distinct and shorter N-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...