Pitx3 (NM_008852) Mouse Untagged Clone

CAT#: MC209172

Pitx3 (untagged) - Mouse paired-like homeodomain transcription factor 3 (Pitx3), (10ug)



  "NM_008852" in other vectors (4)

CNY 3600.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms ak; Ptx3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209172 representing NM_008852
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGTTTGGGCTGCTTGGTGAGGCAGAGGCGCGAAGCCCTGCGCTGTCGTTATCGGACGCAGGCACTC
CACACCCTCCGCTTCCAGAACATGGCTGCAAGGGGCAGGAGCACAGTGACTCGGAGAAGGCCTCGGCCTC
ACTGCCGGGGGGCTCCCCCGAGGACGGCTCTCTGAAGAAGAAGCAGCGGCGGCAGCGCACGCACTTCACC
AGCCAGCAGCTGCAGGAGCTGGAGGCCACCTTCCAGAGGAATCGCTACCCTGACATGAGCACCCGCGAAG
AGATCGCGGTGTGGACCAACCTCACTGAGGCCCGCGTGCGGGTGTGGTTCAAGAACCGGCGCGCAAAGTG
GCGGAAGCGGGAGCGCAGCCAGCAGGCGGAGCTGTGCAAAGGTGGCTTCGCAGCCCCGCTCGGGGGCCTG
GTGCCACCCTACGAGGAGGTGTACCCGGGCTACTCGTACGGCAACTGGCCGCCCAAGGCTCTCGCCCCGC
CGCTCGCCGCCAAGACCTTCCCGTTCGCCTTCAACTCGGTCAACGTGGGGCCTCTGGCTTCACAGCCTGT
ATTCTCACCGCCCAGCTCCATCGCCGCTTCTATGGTGCCCTCGGCCGCCGCTGCCCCGGGCACCGTACCA
GGTCCCGGAGCCTTGCAGGGCCTGGGCGGGGCACCCCCCGGGCTGGCTCCAGCCGCCGTGTCCTCCGGGG
CAGTGTCCTGCCCTTACGCCTCGGCCGCCGCAGCCGCCGCTGCAGCCGCCTCCTCCCCCTATGTATACCG
GGACCCGTGTAACTCGAGCCTGGCTAGCCTGCGGCTCAAAGCCAAGCAGCACGCCTCTTTCAGCTATCCC
GCCGTGCCCGGGCCGCCGCCGGCCGCTAACCTTAGCCCCTGCCAGTACGCCGTGGAACGGCCGGTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008852
Insert Size 909 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC120844, AAI20845
RefSeq Size 1227 bp
RefSeq ORF 909 bp
Locus ID 18742
UniProt ID O35160
Gene Summary Transcriptional regulator which is important for the differentiation and maintenance of meso-diencephalic dopaminergic (mdDA) neurons during development. In addition to its importance during development, it also has roles in the long-term survival and maintenance of the mdDA neurons. Activates NR4A2/NURR1-mediated transcription of genes such as SLC6A3, SLC18A2, TH and DRD2 which are essential for development of mdDA neurons. Acts by decreasing the interaction of NR4A2/NURR1 with the corepressor NCOR2/SMRT which acts through histone deacetylases (HDACs) to keep promoters of NR4A2/NURR1 target genes in a repressed deacetylated state. Essential for the normal lens development and differentiation. Plays a critical role in the maintenance of mitotic activity of lens epithelial cells, fiber cell differentiation and in the control of the temporal and spatial activation of fiber cell-specific crystallins. Positively regulates FOXE3 expression and negatively regulates PROX1 in the anterior lens epithelium, preventing activation of CDKN1B/P27Kip1 and CDKN1C/P57Kip2 and thus maintains lens epithelial cells in cell cycle.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...