Pim2 (NM_138606) Mouse Untagged Clone

CAT#: MC209167

Pim2 (untagged) - Mouse proviral integration site 2 (Pim2), (10ug)



  "NM_138606" in other vectors (6)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
PIM2 Antibody - middle region
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms DXCch3; Pim-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209167 representing NM_138606
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC



ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_138606
Insert Size 1113 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_138606.2, NP_613072.1
RefSeq Size 2054 bp
RefSeq ORF 1113 bp
Locus ID 18715
UniProt ID Q62070
Gene Summary Proto-oncogene with serine/threonine kinase activity involved in cell survival and cell proliferation. Exerts its oncogenic activity through: the regulation of MYC transcriptional activity, the regulation of cell cycle progression, the regulation of cap-dependent protein translation and through survival signaling by phosphorylation of a pro-apoptotic protein, BAD. Phosphorylation of MYC leads to an increase of MYC protein stability and thereby an increase of transcriptional activity. The stabilization of MYC exerted by PIM2 might explain partly the strong synergism between these 2 oncogenes in tumorigenesis. Regulates cap-dependent protein translation in a mammalian target of rapamycin complex 1 (mTORC1)-independent manner and in parallel to the PI3K-Akt pathway. Mediates survival signaling through phosphorylation of BAD, which induces release of the anti-apoptotic protein Bcl-X(L)/BCL2L1. Promotes cell survival in response to a variety of proliferative signals via positive regulation of the I-kappa-B kinase/NF-kappa-B cascade; this process requires phosphorylation of MAP3K8/COT. Promotes growth factor-independent proliferation by phosphorylation of cell cycle factors such as CDKN1A and CDKN1B. Involved in the positive regulation of chondrocyte survival and autophagy in the epiphyseal growth plate.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...