Ngf (NM_013609) Mouse Untagged Clone
CAT#: MC209030
Ngf (untagged) - Mouse nerve growth factor (Ngf), transcript variant A, (10ug)
CNY 3600.00
Product images
                    
                Specifications
| Product Data | |
| Type | Mouse Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | beta-NGF; Ngfb | 
| Vector | pCMV6-Entry | 
| E. coli Selection | Kanamycin (25 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | 
                
                
                
                 >MC209030 representing NM_013609 
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGTGCCTCAAGCCAGTGAAATTAGGCTCCCTGGAGGTGGGACACGGGCAGCATGGTGGAGTTTTGG CCTGTGGTCGTGCAGTCCAGGGGGCTGGATGGCATGCTGGACCCAAGCTCACCTCAGTGTCTGGGCCCAA TAAAGGTTTTGCCAAGGACGCAGCTTTCTATACTGGCCGCAGTGAGGTGCATAGCGTAATGTCCATGTTG TTCTACACTCTGATCACTGCGTTTTTGATCGGCGTACAGGCAGAACCGTACACAGATAGCAATGTCCCAG AAGGAGACTCTGTCCCTGAAGCCCACTGGACTAAACTTCAGCATTCCCTTGACACAGCCCTCCGCAGAGC CCGCAGTGCCCCTACTGCACCAATAGCTGCCCGAGTGACAGGGCAGACCCGCAACATCACTGTAGACCCC AGACTGTTTAAGAAACGGAGACTCCACTCACCCCGTGTGCTGTTCAGCACCCAGCCTCCACCCACCTCTT CAGACACTCTGGATCTAGACTTCCAGGCCCATGGTACAATCCCTTTCAACAGGACTCACCGGAGCAAGCG CTCATCCACCCACCCAGTCTTCCACATGGGGGAGTTCTCAGTGTGTGACAGTGTCAGTGTGTGGGTTGGA GATAAGACCACAGCCACAGACATCAAGGGCAAGGAGGTGACAGTGCTGGCCGAGGTGAACATTAACAACA GTGTATTCAGACAGTACTTTTTTGAGACCAAGTGCCGAGCCTCCAATCCTGTTGAGAGTGGGTGCCGGGG CATCGACTCCAAACACTGGAACTCATACTGCACCACGACTCACACCTTCGTCAAGGCGTTGACAACAGAT GAGAAGCAGGCTGCCTGGAGGTTCATCCGGATAGACACAGCCTGTGTGTGTGTGCTCAGCAGGAAGGCTA CAAGAAGAGGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA  | 
        
| Restriction Sites | SgfI-MluI | 
| ACCN | NM_013609 | 
| Insert Size | 924 bp | 
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info  | 
        
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_013609.3, NP_038637.1 | 
| RefSeq Size | 1196 bp | 
| RefSeq ORF | 924 bp | 
| Locus ID | 18049 | 
| UniProt ID | P01139 | 
| Gene Summary | Nerve growth factor is important for the development and maintenance of the sympathetic and sensory nervous systems (PubMed:20036257). Extracellular ligand for the NTRK1 and NGFR receptors, activates cellular signaling cascades to regulate neuronal proliferation, differentiation and survival (PubMed:22649032). The immature NGF precursor (proNGF) functions as ligand for the heterodimeric receptor formed by SORCS2 and NGFR, and activates cellular signaling cascades that lead to inactivation of RAC1 and/or RAC2, reorganization of the actin cytoskeleton and neuronal growth cone collapse (PubMed:22155786). In contrast to mature NGF, the precursor form (proNGF) promotes neuronal apoptosis (in vitro) (PubMed:20036257). Inhibits metalloproteinase-dependent proteolysis of platelet glycoprotein VI (By similarity). Binds lysophosphatidylinositol and lysophosphatidylserine between the two chains of the homodimer (PubMed:22649032, PubMed:26144237). The lipid-bound form promotes histamine relase from mast cells, contrary to the lipid-free form (PubMed:22649032).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (A).  | 
        
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| MG225453 | Ngf (tGFP-tagged) - Mouse nerve growth factor (Ngf) transcript variant A, (10ug) | 
                                                     CNY 5200.00  | 
                                            |
| MR225453 | Ngf (Myc-DDK-tagged) - Mouse nerve growth factor (Ngf), transcript variant A | 
                                                     CNY 3600.00  | 
                                            |
| MR225453L3 | Lenti ORF clone of Ngf (Myc-DDK-tagged) - Mouse nerve growth factor (Ngf), transcript variant A | 
                                                     CNY 5890.00  | 
                                            |
| MR225453L4 | Lenti ORF clone of Ngf (mGFP-tagged) - Mouse nerve growth factor (Ngf), transcript variant A | 
                                                     CNY 5890.00  | 
                                            
