Mesp2 (NM_008589) Mouse Untagged Clone

CAT#: MC208960

Mesp2 (untagged) - Mouse mesoderm posterior 2 (Mesp2), (10ug)



  "NM_008589" in other vectors (4)

CNY 3990.00


货期*
6周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-MESP2 Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms bHLHc6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208960 representing NM_008589
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCAGTCGCCTCCTCCTCAGAGCCTCCAGGGTCTCGACCACTGGGTCTTCTCCCAGGGCTGGGGCT
GGGCTCAGCAATCGGACTCCACGTCTCCGGCCTCGTCCTCAGATTCGTCCGGTTCCTGCCCTTGCTACGC
CACCCGTCGGCCCTCGCAGCCCGCCGGCCCGGCCCGTAGCACGCGCACTACCCAGGCGACGGCGCCCCGA
CGAACGCGCCCAGCGCCCGCAGGCGGACAGCGGCAGAGCGCCAGCGAGCGCGAGAAGCTGCGCATGCGCA
CACTCGCCCGCGCGCTGCAAGAACTGCGCCGCTTCCTGCCGCCGTCGGTGGCACCTGCAGGCCAGAGCCT
GACCAAGATCGAGACGCTGCGCCTGGCCATCCGCTACATCGGCCACCTGTCAGCCCTGCTGGGCCTCAGC
GAGGACAGTCTGCGGCGCAGGCGCCGACGGAGTGCGGACGCGGCGTTCTCTCACCGATGCCCTCAATGCC
CCGACGGTGGCAGCCCCTCACAGGCTCAGATGCTTGGTCCTAGCCTGGGATCAGCCATGAGTAGTGGGGT
GTCCTGGGGGTGCCCGCCTGCTTGTCCTGGACCTCTGATCTCACCTGAAAACCTTGGGAACAGGATCTCC
AACGTGGATCCCTGGGTGACACCTCCTTATTGTCCCCAAATACAGTCACCCTTACACCAGTCCCTAGAAA
GAGCCGCTGACTCCTCTCCCTGGGCACCACCTCAAGCATGTCCTGGCATGCAGATGTCCCCAGAGCCTAG
GAACAAGACTGGACACTGGACACAATCCACTGAACCTGCAGAGCTGACTAAAGTGTATCAGAGTCTTTCT
GTGTCTCCAGAACCCTGCCTGTCCCTGGGAAGCCCACTTCTCCTGCCCCGCCCATCATGCCAGAGACTAC
AGCCTCAGCCTCAGCCTCAGCCTCAGTGGGGCTGCTGGGGCCACGATGCAGAGGTGCTCTCCACCTCTGA
GGATCAGGGTTCCAGCCCTGCCCTCCAGCTTCCTGTGGCCAGCCCCACCCCCAGCTCAGGCCTGCAGCTC
AGTGGCTGTCCTGAACTTTGGCAGGAAGACCTGGAAGGACCCCCACTGAATATTTTCTACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008589
Insert Size 1113 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_008589.2, NP_032615.2
RefSeq Size 1936 bp
RefSeq ORF 1113 bp
Locus ID 17293
UniProt ID O08574
Gene Summary Transcription factor with important role in somitogenesis. Defines the rostrocaudal patterning of the somite by participating in distinct Notch pathways. Regulates also the FGF signaling pathway. Specifies the rostral half of the somites. Generates rostro-caudal polarity of somites by down-regulating in the presumptive rostral domain DLL1, a Notch ligand. Participates in the segment border formation by activating in the anterior presomitic mesoderm LFNG, a negative regulator of DLL1-Notch signaling. Acts as a strong suppressor of Notch activity. Together with MESP1 is involved in the epithelialization of somitic mesoderm and in the development of cardiac mesoderm. May play a role with Tcf15 in the differentiation of myotomal and sclerotomal cells by regulating Pax family genes. Controls also the expression of the protocadherin PCDH8/PAPC, EPHA4, RIPPLY2, NOTCH2, FGFR1, and CER1. Binds to the E-boxes within the EPH4A and RIPPLY2 enhancers.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...