Rab8a (NM_023126) Mouse Untagged Clone
CAT#: MC208958
Rab8a (untagged) - Mouse RAB8A, member RAS oncogene family (Rab8a), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AA409338; Mel |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208958 representing NM_023126
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGAAGACCTACGATTACCTGTTCAAGCTGCTGCTGATCGGGGACTCGGGGGTAGGGAAGACCTGTG TCCTGTTCCGCTTCTCCGAGGACGCCTTCAACTCCACATTCATCTCTACCATAGGAATTGACTTTAAAAT TAGGACCATAGAGCTCGATGGCAAGAGGATTAAACTGCAGATATGGGACACGGCCGGCCAGGAGCGGTTT CGAACAATCACGACAGCCTACTACAGGGGTGCCATGGGTATCATGCTGGTCTACGACATTACCAATGAGA AGTCCTTTGACAACATCCGGAATTGGATTCGGAACATTGAAGAGCATGCCTCTGCAGACGTGGAGAAGAT GATACTGGGGAATAAGTGTGATGTGAATGACAAGAGACAGGTGTCCAAGGAACGGGGAGAAAAGCTGGCA CTCGACTATGGGATCAAGTTCATGGAGACCAGTGCAAAGGCCAACATCAATGTGGAGAATGCATTTTTCA CTCTTGCCAGGGATATCAAAGCAAAAATGGACAAAAAATTGGAAGGGAACAGCCCGCAGGGGAGCAGCCA TGGAGTCAAGATCACAGTGGAGCAGCAGAAGAGGACCAGCTTCTTCCGGTGCAGTCTCCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_023126 |
Insert Size | 624 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_023126.2, NP_075615.2 |
RefSeq Size | 2012 bp |
RefSeq ORF | 624 bp |
Locus ID | 17274 |
UniProt ID | P55258 |
Gene Summary | The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. That Rab is involved in polarized vesicular trafficking and neurotransmitter release. Together with RAB11A, RAB3IP, the exocyst complex, PARD3, PRKCI, ANXA2, CDC42 and DNMBP promotes transcytosis of PODXL to the apical membrane initiation sites (AMIS), apical surface formation and lumenogenesis. Together with MYO5B and RAB11A participates in epithelial cell polarization. Plays an important role in ciliogenesis (By similarity). Together with MICALL2, may also regulate adherens junction assembly (PubMed:18094055). May play a role in insulin-induced transport to the plasma membrane of the glucose transporter GLUT4 and therefore play a role in glucose homeostasis (By similarity). Involved in autophagy (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202203 | Rab8a (tGFP-tagged) - Mouse RAB8A, member RAS oncogene family (Rab8a) |
CNY 5200.00 |
|
MR202203 | Rab8a (Myc-DDK-tagged) - Mouse RAB8A, member RAS oncogene family (Rab8a) |
CNY 3600.00 |
|
MR202203L3 | Lenti ORF clone of Rab8a (Myc-DDK-tagged) - Mouse RAB8A, member RAS oncogene family (Rab8a) |
CNY 5890.00 |
|
MR202203L4 | Lenti ORF clone of Rab8a (mGFP-tagged) - Mouse RAB8A, member RAS oncogene family (Rab8a) |
CNY 5890.00 |