Mbd3 (NM_013595) Mouse Untagged Clone
CAT#: MC208942
Mbd3 (untagged) - Mouse methyl-CpG binding domain protein 3 (Mbd3), (10ug)
CNY 3600.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI181826; AU019209 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208942 representing NM_013595
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCGGAAGAGGTGGGAGTGCCCGGCGCTCCCGCAGGGCTGGGAAAGGGAAGAAGTGCCCAGGAGGT CGGGGCTGTCGGCCGGCCACAGGGATGTCTTTTACTATAGCCCCAGCGGGAAGAAGTTCCGCAGCAAGCC ACAACTGGCACGTTACCTGGGCGGATCCATGGACCTCAGCACCTTCGACTTCCGCACCGGAAAGATGTTG ATGAACAAGATGAATAAGAGTCGCCAGCGTGTGCGCTATGATTCTTCCAACCAGGTCAAGGGCAAGCCTG ACCTGAACACCGCGCTGCCTGTACGGCAGACTGCATCCATCTTCAAGCAACCGGTGACCAAGATCACCAA CCACCCCAGCAACAAGGTCAAGAGCGACCCGCAGAAGGCAGTGGACCAGCCGAGGCAGCTTTTCTGGGAG AAGAAGCTAAGTGGATTGAGTGCCTTTGACATTGCAGAAGAACTGGTCAGGACCATGGACTTGCCCAAGG GCCTGCAGGGAGTGGGCCCTGGCTGTACAGATGAGACGCTGCTGTCAGCCATTGCGAGTGCTCTACACAC CAGCACCCTGCCCATTACAGGCCAGCTCTCTGCAGCCGTGGAGAAGAACCCTGGTGTGTGGCTGAACACT GCACAGCCACTGTGCAAAGCCTTCATGGTGACAGATGACGACATCAGGAAGCAGGAGGAGCTGGTACAGC AGGTACGGAAGCGCCTGGAGGAGGCACTGATGGCCGACATGCTAGCTCATGTGGAGGAGCTTGCCCGAGA CGGGGAGGCACCACTGGACAAGGCCTGTGCAGAGGAGGAAGAGGAGGAGGAAGAGGAGGAGGAAGAGCCG GAGCCAGAGCGAGTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_013595 |
Insert Size | 858 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_013595.2, NP_038623.1 |
RefSeq Size | 1589 bp |
RefSeq ORF | 858 bp |
Locus ID | 17192 |
UniProt ID | Q9Z2D8 |
Gene Summary | This gene encodes a member of the MBD family of nuclear proteins that contain a methyl-CpG binding domain (MBD). The encoded protein is a component of the nucleosome remodeling and histone deacetylation (NuRD) complex. Deletion of this gene causes embryonic lethality in mice. Embryonic stem cells lacking the encoded protein are severely compromised in their ability to differentiate and fail to commit to developmental lineages in the absence of leukemia inhibitory factor. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222862 | Mbd3 (tGFP-tagged) - Mouse methyl-CpG binding domain protein 3 (Mbd3), (10ug) |
CNY 5200.00 |
|
MR222862 | Mbd3 (Myc-DDK-tagged) - Mouse methyl-CpG binding domain protein 3 (Mbd3) |
CNY 3600.00 |
|
MR222862L3 | Lenti ORF clone of Mbd3 (Myc-DDK-tagged) - Mouse methyl-CpG binding domain protein 3 (Mbd3) |
CNY 5890.00 |
|
MR222862L4 | Lenti ORF clone of Mbd3 (mGFP-tagged) - Mouse methyl-CpG binding domain protein 3 (Mbd3) |
CNY 5890.00 |