Il17a (NM_010552) Mouse Untagged Clone

CAT#: MC208774

Il17a (untagged) - Mouse interleukin 17A (Il17a), (10ug)



  "NM_010552" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rat monoclonal Mouse IL-17A antibody
    • 100 ug

CNY 8,303.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Ctl; Ctla; Ctla-8; Ctla8; Il; IL-; IL-17; IL-17A; Il17
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208774 representing NM_010552
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTCCAGGGAGAGCTTCATCTGTGTCTCTGATGCTGTTGCTGCTGCTGAGCCTGGCGGCTACAGTGA
AGGCAGCAGCGATCATCCCTCAAAGCTCAGCGTGTCCAAACACTGAGGCCAAGGACTTCCTCCAGAATGT
GAAGGTCAACCTCAAAGTCTTTAACTCCCTTGGCGCAAAAGTGAGCTCCAGAAGGCCCTCAGACTACCTC
AACCGTTCCACGTCACCCTGGACTCTCCACCGCAATGAAGACCCTGATAGATATCCCTCTGTGATCTGGG
AAGCTCAGTGCCGCCACCAGCGCTGTGTCAATGCGGAGGGAAAGCTGGACCACCACATGAATTCTGTTCT
CATCCAGCAAGAGATCCTGGTCCTGAAGAGGGAGCCTGAGAGCTGCCCCTTCACTTTCAGGGTCGAGAAG
ATGCTGGTGGGTGTGGGCTGCACCTGCGTGGCCTCGATTGTCCGCCAGGCAGCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010552
Insert Size 477 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC119303, AAI19304
RefSeq Size 569 bp
RefSeq ORF 477 bp
Locus ID 16171
UniProt ID Q62386
Gene Summary This gene encodes a pro-inflammatory cytokine that is a member of the interleukin-17 family. The encoded protein plays a central role in host defense against diverse pathogens. The encoded protein is produced by activated T-cells and certain cell types of innate immune system. The active protein functions as either a homodimer with other interleukin-17 family members and signals through the interleukin-17 receptor to induce inflammatory cytokine production. Aberrant expression of this gene is associated with autoinflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis. [provided by RefSeq, Sep 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...