Il11 (NM_008350) Mouse Untagged Clone
CAT#: MC208766
Il11 (untagged) - Mouse interleukin 11 (Il11), (10ug)
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | IL-11 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208766 representing NM_008350
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAACTGTGTTTGTCGCCTGGTCCTGGTGGTGCTGAGCCTCTGGCCAGATAGAGTCGTTGCCCCTGGGC CACCAGCTGGCTCCCCTCGAGTCTCTTCAGACCCTCGAGCAGATCTGGACAGCGCTGTTCTCCTAACCCG ATCCCTCCTGGCAGACACACGGCAACTAGCTGCACAGATGAGAGACAAATTCCCAGCTGACGGAGATCAC AGTCTGGACTCCCTGCCCACCTTGGCCATGAGCGCTGGGACATTGGGATCTTTGCAGCTTCCTGGTGTGC TGACAAGGCTTCGAGTAGACTTGATGTCCTACCTCCGGCATGTACAATGGCTGCGCCGTGCAGGTGGTCC TTCCCTAAAGACTCTGGAGCCAGAGCTGGGTGCCCTGCAAGCCCGACTGGAACGGCTACTCCGCCGTTTA CAGCTCTTGATGTCTCGCCTGGCCTTGCCCCAGGCAGCCCCAGACCAACCTGTGATCCCCCTGGGCCCTC CTGCCTCAGCCTGGGGAAGCATCCGGGCAGCTCATGCCATCCTAGGAGGGCTGCACCTGACCTTGGACTG GGCCGTGCGGGGCCTGCTGTTGTTAAAGACTCGACTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_008350 |
| Insert Size | 600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_008350.4, NP_032376.1 |
| RefSeq Size | 1949 bp |
| RefSeq ORF | 600 bp |
| Locus ID | 16156 |
| UniProt ID | P47873 |
| Gene Summary | Cytokine that stimulates the proliferation of hematopoietic stem cells and megakaryocyte progenitor cells and induces megakaryocyte maturation resulting in increased platelet production (PubMed:8913282). Also promotes the proliferation of hepatocytes in response to liver damage (PubMed:22253262). Binding to its receptor formed by IL6ST and either IL11RA1 or IL11RA2 activates a signaling cascade that promotes cell proliferation, also in the context of various cancers (PubMed:10026196, PubMed:23948300). Signaling leads to the activation of intracellular protein kinases and the phosphorylation of STAT3 (PubMed:23948300, PubMed:22253262).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG219466 | Il11 (tGFP-tagged) - Mouse interleukin 11 (Il11), (10ug) |
CNY 4000.00 |
|
| MR219466 | Il11 (Myc-DDK-tagged) - Mouse interleukin 11 (Il11) |
CNY 2400.00 |
|
| MR219466L3 | Lenti ORF clone of Il11 (Myc-DDK-tagged) - Mouse interleukin 11 (Il11) |
CNY 4750.00 |
|
| MR219466L4 | Lenti ORF clone of Il11 (mGFP-tagged) - Mouse interleukin 11 (Il11) |
CNY 4750.00 |

