Ifng (NM_008337) Mouse Untagged Clone
CAT#: MC208752
Ifng (untagged) - Mouse interferon gamma (Ifng), (10ug)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | If; If2f; Ifg; IFN-g |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208752 representing NM_008337
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAACGCTACACACTGCATCTTGGCTTTGCAGCTCTTCCTCATGGCTGTTTCTGGCTGTTACTGCCACG GCACAGTCATTGAAAGCCTAGAAAGTCTGAATAACTATTTTAACTCAAGTGGCATAGATGTGGAAGAAAA GAGTCTCTTCTTGGATATCTGGAGGAACTGGCAAAAGGATGGTGACATGAAAATCCTGCAGAGCCAGATT ATCTCTTTCTACCTCAGACTCTTTGAAGTCTTGAAAGACAATCAGGCCATCAGCAACAACATAAGCGTCA TTGAATCACACCTGATTACTACCTTCTTCAGCAACAGCAAGGCGAAAAAGGATGCATTCATGAGTATTGC CAAGTTTGAGGTCAACAACCCACAGGTCCAGCGCCAAGCATTCAATGAGCTCATCCGAGTGGTCCACCAG CTGTTGCCGGAATCCAGCCTCAGGAAGCGGAAAAGGAGTCGCTGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_008337 |
Insert Size | 468 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC119063, AAI19064 |
RefSeq Size | 958 bp |
RefSeq ORF | 468 bp |
Locus ID | 15978 |
UniProt ID | P01580 |
Gene Summary | This gene encodes a soluble cytokine that is a member of the type II interferon class. The encoded protein is secreted by cells of both the innate and adaptive immune systems. The active protein is a homodimer that binds to the interferon gamma receptor which triggers a cellular response to viral and microbial infections. Mice deficient in this gene have increased susceptibility to viral, bacterial and parasitic infections and to several autoimmune diseases. [provided by RefSeq, Dec 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227155 | Ifng (tGFP-tagged) - Mouse interferon gamma (Ifng), (10ug) |
CNY 2,800.00 |
|
MR227155 | Ifng (Myc-DDK-tagged) - Mouse interferon gamma (Ifng) |
CNY 1,200.00 |
|
MR227155L3 | Lenti ORF clone of Ifng (Myc-DDK-tagged) - Mouse interferon gamma (Ifng) |
CNY 3,600.00 |
|
MR227155L4 | Lenti ORF clone of Ifng (mGFP-tagged) - Mouse interferon gamma (Ifng) |
CNY 3,600.00 |