Hcrt (NM_010410) Mouse Untagged Clone
CAT#: MC208652
Hcrt (untagged) - Mouse hypocretin (Hcrt), (10ug)
CNY 3990.00
Product images
                    
                Specifications
| Product Data | |
| Type | Mouse Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | PPOX | 
| Vector | pCMV6-Entry | 
| E. coli Selection | Kanamycin (25 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | 
                
                
                
                 >MC208652 representing NM_010410 
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAACTTTCCTTCTACAAAGGTTCCCTGGGCCGCCGTGACGCTGCTGCTGCTGCTACTGCTGCCGCCGG CGCTGCTGTCGCTTGGGGTGGACGCACAGCCTCTGCCCGACTGCTGTCGCCAGAAGACGTGTTCCTGCCG TCTCTACGAACTGTTGCACGGAGCTGGCAACCACGCTGCGGGTATCCTGACTCTGGGAAAGCGGCGGCCT GGACCTCCAGGCCTCCAGGGACGGCTGCAGCGCCTCCTTCAGGCCAACGGTAACCACGCAGCTGGCATCC TGACCATGGGCCGCCGCGCAGGCGCAGAGCTAGAGCCACATCCCTGCTCTGGTCGCGGCTGTCCGACCGT AACTACCACCGCTTTAGCACCCCGGGGAGGGTCCGGAGTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA  | 
        
| Restriction Sites | SgfI-MluI | 
| ACCN | NM_010410 | 
| Insert Size | 393 bp | 
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_010410.2, NP_034540.1 | 
| RefSeq Size | 584 bp | 
| RefSeq ORF | 393 bp | 
| Locus ID | 15171 | 
| UniProt ID | O55241 | 
| Gene Summary | This gene encodes a hypothalamic neuropeptide precursor protein that gives rise to two mature neuropeptides, orexin A and orexin B, by proteolytic processing. Orexin A and orexin B, which bind to orphan G-protein coupled receptors Hcrtr1 and Hcrtr2, function in the regulation of sleep and arousal. This neuropeptide arrangement may also play a role in feeding behavior, metabolism, and homeostasis. [provided by RefSeq, Sep 2015] | 
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| MG222595 | Hcrt (tGFP-tagged) - Mouse hypocretin (Hcrt), (10ug) | 
                                                     CNY 2850.00  | 
                                            |
| MR222595 | Hcrt (Myc-DDK-tagged) - Mouse hypocretin (Hcrt) | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 1200.00  | 
                                            |
| MR222595L3 | Lenti ORF clone of Hcrt (Myc-DDK-tagged) - Mouse hypocretin (Hcrt) | 
                                                     CNY 4750.00  | 
                                            |
| MR222595L4 | Lenti ORF clone of Hcrt (mGFP-tagged) - Mouse hypocretin (Hcrt) | 
                                                     CNY 4750.00  | 
                                            
