Gnrh1 (NM_008145) Mouse Untagged Clone
CAT＃: MC208575
Gnrh1 (untagged) - Mouse gonadotropin releasing hormone 1 (Gnrh1), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Gnrh; Gnrh2; hpg; L; LH; LHRH; Lhrh1; Lnrh |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208575 representing NM_008145
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATCCTCAAACTGATGGCCGGCATTCTACTGCTGACTGTGTGTTTGGAAGGCTGCTCCAGCCAGCACT GGTCCTATGGGTTGCGCCCTGGGGGAAAGAGAAACACTGAACACTTGGTTGAGTCTTTCCAAGAGATGGG CAAGGAGGTGGATCAAATGGCAGAACCCCAGCACTTCGAATGTACTGTCCACTGGCCCCGTTCACCCCTC AGGGATCTGCGAGGAGCTCTGGAAAGTCTGATTGAAGAGGAAGCCAGGCAGAAGAAGATGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_008145 |
| Insert Size | 273 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_008145.3, NP_032171.1 |
| RefSeq Size | 580 bp |
| RefSeq ORF | 273 bp |
| Locus ID | 14714 |
| UniProt ID | P13562 |
| Gene Summary | This gene encodes hypophysiotropic peptides belonging to the family of gonadotropin-releasing hormones that stimulate the release of gonadotropins and suppress secretion of prolactin from the pituitary gland. The encoded protein is proteolytically processed to generate two biologically active mature peptides. A deletional mutation encompassing the distal half of this gene in mice resulting in the loss of the encoded protein leads to hypogonadism and infertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the functional protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG226103 | Gnrh1 (tGFP-tagged) - Mouse gonadotropin releasing hormone 1 (Gnrh1), (10ug) |
CNY 4370.00 |
|
| MR226103 | Gnrh1 (Myc-DDK-tagged) - Mouse gonadotropin releasing hormone 1 (Gnrh1) |
CNY 1800.00 |
|
| MR226103L3 | Lenti ORF clone of Gnrh1 (Myc-DDK-tagged) - Mouse gonadotropin releasing hormone 1 (Gnrh1) |
CNY 5890.00 |
|
| MR226103L4 | Lenti ORF clone of Gnrh1 (mGFP-tagged) - Mouse gonadotropin releasing hormone 1 (Gnrh1) |
CNY 5890.00 |
