Ghrh (NM_010285) Mouse Untagged Clone
CAT#: MC208549
Ghrh (untagged) - Mouse growth hormone releasing hormone (Ghrh), (10ug)
CNY 3990.00
Product images
                    
                Specifications
| Product Data | |
| Type | Mouse Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | Ghr; Ghrf; GRF | 
| Vector | pCMV6-Entry | 
| E. coli Selection | Kanamycin (25 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | 
                
                
                
                 >MC208549 representing NM_010285 
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGCTCTGGGTGCTCTTTGTGATCCTCATCCTCACCAGTGGCTCCCACTGCTCACTGCCCCCCTCAC CTCCCTTCAGGATGCAGCGACACGTAGATGCCATCTTCACCACCAACTACAGGAAACTCCTGAGCCAGCT GTATGCCCGGAAAGTGATCCAGGACATCATGAACAAGCAAGGGGAGAGGATCCAGGAACAAAGGGCCAGG CTCAGCCGCCAGGAAGACAGCATGTGGACAGAGGACAAGCAGATGACCCTGGAGAGCATCTTGCAGGGAT TCCCAAGGATGAAGCCTTCAGCGGACGCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA  | 
        
| Restriction Sites | SgfI-MluI | 
| ACCN | NM_010285 | 
| Insert Size | 312 bp | 
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_010285.2, NP_034415.1 | 
| RefSeq Size | 534 bp | 
| RefSeq ORF | 312 bp | 
| Locus ID | 14601 | 
| UniProt ID | P16043 | 
| Gene Summary | This gene encodes a hormone that has stimulatory effects on pituitary growth hormone synthesis and release, and somatotrope expansion. The encoded preproprotein undergoes proteolytic processing to generate the mature peptide that is secreted by hypothalamus. Mice lacking the encoded protein are deficient in the growth hormone, live longer and exhibit growth retardation, enhanced insulin sensitivity and increased xenobiotic metabolism. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (1) represents the longer transcript and encodes the functional protein. Both variants 1 and 2 encode the same protein.  | 
        
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| MG223015 | Ghrh (tGFP-tagged) - Mouse growth hormone releasing hormone (Ghrh), (10ug) | 
                                                     CNY 2850.00  | 
                                            |
| MR223015 | Ghrh (Myc-DDK-tagged) - Mouse growth hormone releasing hormone (Ghrh) | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 1200.00  | 
                                            |
| MR223015L3 | Lenti ORF clone of Ghrh (Myc-DDK-tagged) - Mouse growth hormone releasing hormone (Ghrh) | 
                                                     CNY 4750.00  | 
                                            |
| MR223015L4 | Lenti ORF clone of Ghrh (mGFP-tagged) - Mouse growth hormone releasing hormone (Ghrh) | 
                                                     CNY 4750.00  | 
                                            
