Gal (NM_010253) Mouse Untagged Clone
CAT#: MC208519
Gal (untagged) - Mouse galanin (Gal), (10ug)
CNY 3990.00
Product images
                    
                Specifications
| Product Data | |
| Type | Mouse Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | G; Galn | 
| Vector | pCMV6-Entry | 
| E. coli Selection | Kanamycin (25 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | 
                
                
                
                 >MC208519 representing NM_010253 
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCAGAGGCAGCGTTATCCTGCTAGGCTGGCTCCTGTTGGTTGTGACCCTGTCAGCCACTCTGGGAC TTGGGATGCCTGCAAAGGAGAAGAGAGGTTGGACCCTGAACAGCGCTGGCTACCTTCTGGGCCCACATGC CATTGACAACCACAGATCATTTAGCGACAAGCATGGCCTCACAGGCAAGAGGGAGTTACAACTGGAGGTG GAGGAAAGGAGACCAGGAAGTGTTGATGTGCCCCTGCCTGAGAGCAACATTGTCCGCACTATAATGGAGT TTCTCAGTTTCTTGCACCTTAAAGAGGCCGGGGCCCTCGACAGCCTGCCTGGCATCCCCTTGGCCACCTC CTCAGAAGACCTAGAGAAGTCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA  | 
        
| Restriction Sites | SgfI-MluI | 
| ACCN | NM_010253 | 
| Insert Size | 375 bp | 
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_010253.3, NP_034383.1 | 
| RefSeq Size | 699 bp | 
| RefSeq ORF | 375 bp | 
| Locus ID | 14419 | 
| UniProt ID | P47212 | 
| Gene Summary | This gene encodes a neuroendocrine peptide that is principally produced by a subpopulation of lactotrophs in the pituitary gland. The encoded protein is a precursor that is proteolytically processed to generate two mature peptides: galanin and galanin message-associated peptide (GMAP). Mice lacking the encoded protein fail to lactate sufficiently due to abnormalities in the expression of prolactin and lactotroph proliferation, exhibit attenuated chronic neuropathic pain and developmental deficits in the dorsal root ganglion neurons. This gene encodes distinct isoforms, some or all of which may undergo similar processing to generate the mature proteins. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (1) represents the longer transcript and encodes the shorter protein (isoform 1).  | 
        
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| MG225635 | Gal (tGFP-tagged) - Mouse galanin (Gal), (10ug) | 
                                                     CNY 2850.00  | 
                                            |
| MR225635 | Gal (Myc-DDK-tagged) - Mouse galanin (Gal) | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 1200.00  | 
                                            |
| MR225635L3 | Lenti ORF clone of Gal (Myc-DDK-tagged) - Mouse galanin (Gal) | 
                                                     CNY 4750.00  | 
                                            |
| MR225635L4 | Lenti ORF clone of Gal (mGFP-tagged) - Mouse galanin (Gal) | 
                                                     CNY 4750.00  | 
                                            
