Fcgr2b (NM_001077189) Mouse Untagged Clone
CAT#: MC208473
Fcgr2b (untagged) - Mouse Fc receptor, IgG, low affinity IIb (Fcgr2b), transcript variant 1, (10ug)
CNY 5488.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI528646; CD32; F630109E10Rik; Fcgr2; Fcgr2a; FcgRII; Fcr-2; Fcr-3; fcRII; Fc[g]RII; Ly-17 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208473 representing NM_001077189
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGAATCCTGCCGTTCCTACTGATCCCCATGGAGAGCAACTGGACTGTCCATGTGTTCTCACGGACTT TGTGCCATATGCTACTGTGGACAGCCGTGCTAAATCTTGCTGCTGGGACTCATGATCTTCCAAAGGCTGT GGTCAAACTCGAGCCCCCGTGGATCCAGGTGCTCAAGGAAGACACGGTGACACTGACATGCGAAGGGACC CACAACCCTGGGAACTCTTCTACCCAGTGGTTCCACAATGGGAGGTCCATCCGGAGCCAGGTCCAAGCCA GCTACACGTTTAAGGCCACAGTCAATGACAGTGGAGAATATCGGTGTCAAATGGAGCAGACCCGCCTCAG CGACCCTGTAGATCTGGGAGTGATTTCTGACTGGCTGCTGCTCCAGACCCCTCAGCTGGTGTTTCTGGAA GGGGAAACCATCACGCTAAGGTGCCATAGCTGGAGGAACAAACTACTGAACAGGATCTCGTTCTTCCATA ATGAAAAATCCGTGAGGTATCATCACTACAGTAGTAATTTCTCTATCCCAAAAGCCAACCACAGTCACAG TGGGGACTACTACTGCAAAGGAAGTCTAGGAAGGACACTGCACCAGTCCAAGCCTGTCACCATCACTGTC CAAGGGCCCAAGTCCAGCAGGTCTTTACCAGTATTGACAATTGTGGCTGCTGTCACTGGGATTGCTGTCG CAGCCATTGTTATTATCCTAGTATCCTTGGTCTATCTCAAGAAAAAGCAGGTTCCAGCTCTCCCAGGAAA CCCTGATCACAGGGAAATGGGAGAAACCCTTCCAGAGGAAGTAGGTGAGTACAGACAGCCCTCTGGGGGC TCAGTGCCTGTCAGCCCAGGGCCTCCATCTGGACTGGAGCCAACAAGCAGCAGCCCATACAATCCTCCTG ATCTGGAAGAAGCTGCCAAAACTGAGGCTGAGAATACGATCACCTACTCACTTCTCAAGCATCCCGAAGC CCTGGATGAAGAAACAGAGCATGATTACCAGAACCACATTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_001077189 |
Insert Size | 1023 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001077189.1, NP_001070657.1 |
RefSeq Size | 1556 bp |
RefSeq ORF | 1023 bp |
Locus ID | 14130 |
Gene Summary | Receptor for the Fc region of complexed immunoglobulins gamma. Low affinity receptor. Involved in a variety of effector and regulatory functions such as phagocytosis of antigen-antibody complexes from the circulation and modulation of antibody production by B-cells. Isoform IIB1 and isoform IIB1' form caps but fail to mediate endocytosis or phagocytosis. Isoform IIB2 can mediate the endocytosis of soluble immune complexes via clathrin-coated pits. Isoform IIB1 and isoform IIB2 can down-regulate B-cell, T-cell, and mast cell activation when coaggregated to B-cell receptors for AG (BCR), T-cell receptors for AG (TCR), and Fc receptors, respectively.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227678 | Fcgr2b (tGFP-tagged) - Mouse Fc receptor IgG low affinity IIb (Fcgr2b) transcript variant 1, (10ug) |
CNY 7088.00 |
|
MR227678 | Fcgr2b (Myc-DDK-tagged) - Mouse Fc receptor, IgG, low affinity IIb (Fcgr2b), transcript variant 1 |
CNY 5488.00 |
|
MR227678L1 | Lenti ORF clone of Fcgr2b (Myc-DDK-tagged) - Mouse Fc receptor, IgG, low affinity IIb (Fcgr2b), transcript variant 1 |
CNY 5890.00 |
|
MR227678L2 | Lenti ORF clone of Fcgr2b (mGFP-tagged) - Mouse Fc receptor, IgG, low affinity IIb (Fcgr2b), transcript variant 1 |
CNY 7888.00 |
|
MR227678L3 | Lenti ORF clone of Fcgr2b (Myc-DDK-tagged) - Mouse Fc receptor, IgG, low affinity IIb (Fcgr2b), transcript variant 1 |
CNY 7888.00 |
|
MR227678L4 | Lenti ORF clone of Fcgr2b (mGFP-tagged) - Mouse Fc receptor, IgG, low affinity IIb (Fcgr2b), transcript variant 1 |
CNY 7888.00 |