Fas (NM_001146708) Mouse Untagged Clone
CAT#: MC208466
Fas (untagged) - Mouse Fas (TNF receptor superfamily member 6) (Fas), transcript variant 2, (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AI196731; APO1; APT1; CD95; lpr; TNFR6; Tnfrsf6 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208466 representing NM_001146708
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGTGGATCTGGGCTGTCCTGCCTCTGGTGCTTGCTGGCTCACAGTTAAGAGTTCATACTCAAGGTA CTAATAGCATCTCCGAGAGTTTAAAGCTGAGGAGGCGGGTTCGTGAAACTGATAAAAACTGCTCAGAAGG ATTATATCAAGGAGGCCCATTTTGCTGTCAACCATGCCAACCTGAAAACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001146708 |
| Insert Size | 192 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001146708.1, NP_001140180.1 |
| RefSeq Size | 555 bp |
| RefSeq ORF | 192 bp |
| Locus ID | 14102 |
| Gene Summary | Receptor for TNFSF6/FASLG. The adapter molecule FADD recruits caspase-8 to the activated receptor. The resulting death-inducing signaling complex (DISC) performs caspase-8 proteolytic activation which initiates the subsequent cascade of caspases (aspartate-specific cysteine proteases) mediating apoptosis. FAS-mediated apoptosis may have a role in the induction of peripheral tolerance, in the antigen-stimulated suicide of mature T-cells, or both (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) has multiple differences in the presence and absence of exons at its 3' end, compared to variant 1. These differences produce a unique 3' UTR and a protein (isoform 2) with a shorter and distinct C-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG226227 | Fas (tGFP-tagged) - Mouse Fas (TNF receptor superfamily member 6) (Fas) transcript variant 2, (10ug) |
CNY 2090.00 |
|
| MR226227 | Fas (Myc-DDK-tagged) - Mouse Fas (TNF receptor superfamily member 6) (Fas), transcript variant 2 |
CNY 1320.00 |
|
| MR226227L3 | Lenti ORF clone of Fas (Myc-DDK-tagged) - Mouse Fas (TNF receptor superfamily member 6) (Fas), transcript variant 2 |
CNY 3800.00 |
|
| MR226227L4 | Lenti ORF clone of Fas (mGFP-tagged) - Mouse Fas (TNF receptor superfamily member 6) (Fas), transcript variant 2 |
CNY 3800.00 |
