Edn3 (NM_007903) Mouse Untagged Clone
CAT#: MC208421
Edn3 (untagged) - Mouse endothelin 3 (Edn3), (10ug)
CNY 3600.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | ET-3; ls; PPET3; tmgc48 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_007903, the custom clone sequence may differ by one or more nucleotides
ATGGAGCCGGGGCTGTGGCTCCTTCTCGGGCTCACAGTGACCTCCGCTGCAGGACTTGTGCCTTGCCCCC AGTCTGGGGACTCTGGCAGAGCCAGTGTGTCCCAGGGTCCCCCTGAAGCTGGATCAGAGAGGGGCTGTGA AGAGACTGTGGCTGGCCCTGGTGAGAGGATTGTGTCCCCAACAGTTGCACTGCCTGCACAGCCTGAAAGC GCTGGGCAGGAACGGGCACCAGGCAGGTCTGGGAAACAAGAGGACAAGGGGCTGCCTGCACACCACCGCC CTCGCCGCTGCACGTGCTTCACTTACAAGGACAAGGAGTGTGTCTACTATTGCCACCTGGACATCATCTG GATTAACACTCCTGAACAGACTGTGCCCTATGGACTGTCCAACTACAGAGAAAGCCTTCGGGGAAAGAGG TCCTTGGGGCCAGTTCCAGAAAGCTCCCAGCCTTCTCCGTGGACACGCTTGCGTTGTACTTGTATGGGGG CGGATGACAAGGCCTGTGCACACTTCTGTGCACGCACCAGAGATGTCACCAGTTATTCCGGGAGAGCAGA AAGGCCAGCTGCAGAAGAGATGCGGGAGACTGGAGGCCCACGTCAAAGGTTGATGTCAAGGACAGATAAA GCCCACCGGCCTTAG |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_007903 |
| Insert Size | 645 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC137727, AAI37728 |
| RefSeq Size | 2412 bp |
| RefSeq ORF | 645 bp |
| Locus ID | 13616 |
| UniProt ID | P48299 |
| Gene Summary | This gene is a member of the endothelin family whose members encode proteins that act on G protein-coupled receptors. Endothelins are produced as large prepropolypeptide precursors that undergo a first cleavage by a subtilisin serine protease to form an inactive intermediate, which in turn is cleaved again by endothelin-converting enzyme 1 (ECE-1) to yield the active 21 amino acid peptide. This gene encodes a protein which is expressed in neural crest cells (NCC), binds to endothelin receptor b (Ednrb) and plays an essential role in the development of NCC-derived cell lineages including melanocytes and enteric neurons. Mutations in this gene are associated with terminal aganglionosis and white spotted coat in mice and Hirschsprung's disease and Waardenburg syndrome in humans. [provided by RefSeq, Apr 2013] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG220221 | Edn3 (tGFP-tagged) - Mouse endothelin 3 (Edn3), (10ug) |
CNY 4370.00 |
|
| MR220221 | Edn3 (Myc-DDK-tagged) - Mouse endothelin 3 (Edn3) |
CNY 3600.00 |
|
| MR220221L3 | Lenti ORF clone of Edn3 (Myc-DDK-tagged) - Mouse endothelin 3 (Edn3) |
CNY 5890.00 |
|
| MR220221L4 | Lenti ORF clone of Edn3 (mGFP-tagged) - Mouse endothelin 3 (Edn3) |
CNY 5890.00 |
