Defa6 (NM_007852) Mouse Untagged Clone
CAT#: MC208385
Defa6 (untagged) - Mouse defensin, alpha, 6 (Defa6), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Defcr6 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208385 representing NM_007852
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGACACTAATCCTCCTCTCTGCCCTCGTCCTGCTGGCCTTCCAGGTCCAGGCTGATCCTATCCAAA ATACAGATGAAGAGACTAAAACTGAGGAGCAGCCAGGGGAAGAGGACCAGGCTGTGTCTGTCTCTTTTGG AGACCCAGAAGGCACTTCTCTTCAAGAGGAATCATTGAGAGATCTGGTATGCTATTGTAGAGCAAGAGGC TGCAAAGGAAGAGAACGCATGAATGGGACCTGCAGAAAGGGTCATTTATTGTACATGCTCTGCTGTCGCT GA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_007852 |
| Insert Size | 282 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_007852.1, NP_031878.1 |
| RefSeq Size | 282 bp |
| RefSeq ORF | 282 bp |
| Locus ID | 13240 |
| UniProt ID | P50704 |
| Gene Summary | Has broad-spectrum antimicrobial properties. Has antibacterial activity against the Gram-positive bacterium L.monocytogenes EGD and the Gram-negative bacteria E.coli ML-35p and avirulent S.typhimurium 7953, but not against the mouse-virulent S.typhimurium 14028S. Probably contributes to the antimicrobial barrier function of the small bowel mucosa.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG219823 | Defa6 (tGFP-tagged) - Mouse defensin alpha 6 (Defa6), (10ug) |
CNY 2850.00 |
|
| MR219823 | Defa6 (Myc-DDK-tagged) - Mouse defensin, alpha, 6 (Defa6) |
CNY 1200.00 |
|
| MR219823L3 | Lenti ORF clone of Defa6 (Myc-DDK-tagged) - Mouse defensin, alpha, 6 (Defa6) |
CNY 4750.00 |
|
| MR219823L4 | Lenti ORF clone of Defa6 (mGFP-tagged) - Mouse defensin, alpha, 6 (Defa6) |
CNY 4750.00 |
