Dclk1 (NM_001111052) Mouse Untagged Clone

CAT#: MC208365

Dclk1 (untagged) - Mouse doublecortin-like kinase 1 (Dclk1), transcript variant 3, (10ug)



  "NM_001111052" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1700113D08Rik; 2810480F11Rik; AI836758; Clic; Click-I; CPG1; Cpg16; Dc; Dcamk; Dcamkl1; Dcl; Dclk; mKIAA0369
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208365 representing NM_001111052
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTAGAGCTCATAGAAGTTAATGGAACCCCTGGTAGTCAGCTCTCTACTCCACGCTCGGGCAAGTCAC
CAAGTCCATCACCCACCAGCCCAGGAAGCCTGCGGAAGCAGAGGATCTCTCAGCATGGCGGCTCCTCGAC
TTCACTTTCATCCACTAAAGTTTGCAGCTCAATGGATGAGAATGATGGCCCTGGGGAAGAAGAGTCTGAG
GAAGGCTTCCAGATTCCTGCCACAATAACAGAGAGATACAAAGTCGGGAGAACAATAGGAGACGGAAATT
TTGCTGTTGTCAAGGAATGTATAGAGAGGTCGACTGCTCGGGAGTATGCCCTGAAAATCATCAAGAAAAG
CAAATGCCGAGGCAAAGAGCACATGATCCAGAACGAGGTCTCCATCCTACGGAGGGTGAAGCACCCCAAC
ATTGTCCTCCTGATTGAAGAGATGGATGTGCCGACTGAACTGTATCTTGTAATGGAATTAGTGAAGGGTG
GAGACCTTTTCGATGCCATCACCTCCACTAGCAAATACACAGAGAGAGATGCCAGCGGGATGCTGTACAA
CCTGGCCAGCGCCATCAAATACCTGCACAGCCTGAACATCGTCCACCGTGACATCAAGCCAGAGAATCTG
CTGGTGTATGAGCACCAGGATGGCAGTAAGTCACTCAAGTTGGGTGACTTTGGCCTGGCCACAATTGTCG
ACGGCCCCCTGTACACAGTCTGTGGCACCCCAACATATGTGGCTCCAGAAATCATTGCAGAGACTGGATA
TGGCCTCAAGGTGGACATCTGGGCAGCTGGCGTGATCACTTATATCCTGCTGTGTGGCTTCCCTCCGTTC
CGTGGAAGTGGGGATGACCAGGAGGTGCTTTTTGACCAGATCTTGATGGGCCAAGTGGACTTTCCATCTC
CGTATTGGGACAATGTGTCAGATTCTGCTAAGGAGCTCATCAACATGATGCTGTTGGTTAACGTGGACCA
GAGATTTTCAGCCGTGCAGGTCCTTGAGCATCCCTGGGTTAATGATGATGGTCTCCCAGAAAATGAGCAT
CAGCTGTCAGTAGCTGGCAAAATCAAGAAGCATTTCAACACAGGCCCCAAGCCGAGCAGCACTGCAGCAG
GAGTTTCTGTAATAGCACTGGACCACGGGTTTACCATCAAGAGATCAGGGTCTTTGGACTACTACCAACA
ACCAGGAATGTATTGGATAAGACCACCGCTCTTGATAAGGAGAGGCAGGTTTTCCGACGAAGACGCAACC
AGGATGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001111052
Insert Size 1269 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001111052.1, NP_001104522.1
RefSeq Size 7030 bp
RefSeq ORF 1269 bp
Locus ID 13175
Gene Summary This gene encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmodulin-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the encoded protein is independent of its protein kinase activity. The encoded protein is involved in several different cellular processes, including neuronal migration, retrograde transport, neuronal apoptosis and neurogenesis. This gene is up-regulated by brain-derived neurotrophic factor and associated with memory and general cognitive abilities. Multiple transcript variants generated by two alternative promoter usage and alternative splicing have been found, but the biological validity of some variants has not been determined. These variants encode different isoforms, which are differentially expressed and have different kinase activities. [provided by RefSeq, Sep 2010]
Transcript Variant: This variant (3, also known as DCLK-short-B, DCK-beta1 or KIAA0369-BS ) is produced from the 3' promoter. It lacks several 5' exons but has an alternate 5' exon, and has an additional exon in the 3' CDS that results in a frameshift, as compared to variant 5. The resulting isoform (3) has shorter and different N- and C-termini, and lacks doublecortin domains, as compared to isoform 5. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...