Dazl (NM_010021) Mouse Untagged Clone

CAT#: MC208363

Dazl (untagged) - Mouse deleted in azoospermia-like (Dazl), (10ug)



  "NM_010021" in other vectors (4)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Da; Daz-l; Daz-like; Dazh; Dazl1; Dazla; Tpx; Tpx-; Tpx-2; Tpx2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_010021, the custom clone sequence may differ by one or more nucleotides


ATGTCTGCCACAACTTCTGAGGCTCCAAATTCAGCTGTCTCCAGGGAGGCCAGCACTCAGTCTTCATCAG
CAACCACAAGTCAAGGATATGTTTTGCCAGAAGGCAAAATCATGCCAAACACCGTTTTTGTTGGAGGAAT
TGATGTTAGGATGGATGAAACCGAAATCAGGAGTTTCTTTGCCAGATATGGCTCAGTAAAAGAAGTGAAG
ATAATCACTGATCGAACTGGTGTGTCGAAGGGCTATGGATTTGTCTCATTTTATAATGACGTGGATGTGC
AGAAGATAGTAGAATCACAGATAAATTTCCATGGTAAAAAGCTGAAACTGGGCCCTGCAATCAGGAAACA
AAATTTATGTACTTATCATGTGCAGCCACGTCCTTTGATTTTTAATCCTCCTCCTCCACCACAGTTCCAG
AGTGTTTGGAGTAGTCCAAATGCTGAGACTTACATGCAGCCTCCAACCATGATGAATCCTATCACTCAGT
ATGTTCAGGCATATCCTCCTTATCCAAGTTCACCAGTTCGGGTCATCACTGGATATCAGCTGCCTGTTTA
TAACTACCAGATGCCACCGCAGTGGCCTGCTGGAGAGCAGAGGAGTTATGTTATACCTCCGGCTTATACA
ACTGTTAACTACCACTGCAGTGAAGTTGATCCAGGAGCTGATATTTTGCCCAATGAATGTTCAGTTCATG
ATGCTGCTCCAGCTTCTGGAAATGGCCCGCAAAAGAAGTCTGTGGACCGAAGCATACAGACAGTGGTCTC
TTGTCTGTTTAACCCTGAGAACAGGCTGAGAAACTCTCTTGTTACTCAAGATGACTACTTCAAGGATAAA
AGAGTACATCACTTCAGAAGAAGTCGGGCAGTGCTTAAATCTGATCATCTCTGCTAA


Restriction Sites SgfI-MluI     
ACCN NM_010021
Insert Size 897 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC099940, AAH99940
RefSeq Size 2936 bp
RefSeq ORF 897 bp
Locus ID 13164
UniProt ID Q64368
Gene Summary This gene encodes a member of the depleted in azoospermia-like (DAZL) protein family. Members of this family contain an RNA recognition motif, interact with poly A binding proteins, and may be involved in the initiation of translation. The encoded protein is expressed in the cytoplasm of pluripotent stem cells, and in both male and female germ cells, where it is essential for gametogenesis. Disruption of this gene is associated with infertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
Transcript Variant: This variant (1, also known as Dazl_FL) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...