Cnih2 (NM_009920) Mouse Untagged Clone
CAT#: MC208304
Cnih2 (untagged) - Mouse cornichon homolog 2 (Drosophila) (Cnih2), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | C; CNIH-2; Cnil |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208304 representing NM_009920
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGTTCACCTTCGCAGCATTCTGCTACATGCTCACCCTGGTGCTGTGCGCCTCCCTCATCTTCTTTG TCATCTGGCACATCATAGCCTTTGATGAGCTGCGGACTGACTTCAAGAACCCCATCGACCAGGGGAACCC AGCGCGGGCACGCGAGCGTTTGAAAAACATCGAACGCATCTGCTGCCTCCTGAGGAAGCTGGTGGTCCCG GAATATTCCATCCACGGCCTCTTCTGTCTGATGTTTCTGTGTGCAGCAGAGTGGGTGACCCTGGGCCTCA ACATCCCCCTCCTCTTCTACCACCTCTGGAGGTACTTCCACCGTCCTGCGGATGGCTCTGAGGTCATGTA TGATGCGGTCTCTATCATGAATGCTGACATCCTCAACTACTGCCAGAAGGAGTCCTGGTGCAAACTCGCC TTCTACCTGCTGTCCTTCTTCTATTACCTGTACAGTATGGTTTATACGTTGGTGAGCTTCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_009920 |
Insert Size | 483 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_009920.4, NP_034050.1 |
RefSeq Size | 1361 bp |
RefSeq ORF | 483 bp |
Locus ID | 12794 |
UniProt ID | O35089 |
Gene Summary | This gene encodes a protein that is an auxiliary subunit of the ionotropic glutamate receptor of the AMPA subtype. This protein is similar to a Drosophila protein involved in anterior-posterior and dorsal-ventral patterning. Cnih2 conditional knockout mice exhibit reduced AMPA receptor synaptic transmission in the hippocampus. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014] Transcript Variant: This variant (1) represents the shorter transcript and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG225071 | Cnih2 (tGFP-tagged) - Mouse cornichon homolog 2 (Drosophila) (Cnih2), (10ug) |
CNY 2850.00 |
|
MR225071 | Cnih2 (Myc-DDK-tagged) - Mouse cornichon homolog 2 (Drosophila) (Cnih2) |
CNY 1200.00 |
|
MR225071L3 | Lenti ORF clone of Cnih2 (Myc-DDK-tagged) - Mouse cornichon homolog 2 (Drosophila) (Cnih2) |
CNY 4750.00 |
|
MR225071L4 | Lenti ORF clone of Cnih2 (mGFP-tagged) - Mouse cornichon homolog 2 (Drosophila) (Cnih2) |
CNY 4750.00 |