Ccr2 (NM_009915) Mouse Untagged Clone

CAT#: MC208298

Ccr2 (untagged) - Mouse chemokine (C-C motif) receptor 2 (Ccr2), (10ug)



  "NM_009915" in other vectors (6)

CNY 3656.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Cc-ckr-2; Ccr2a; Ccr2b; Ckr2; Ckr2a; Ckr2b; Cmkbr2; mJe-r
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208298 representing NM_009915
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAGACAATAATATGTTACCTCAGTTCATCCACGGCATACTATCAACATCTCATTCTCTATTTACAC
GAAGTATCCAAGAGCTTGATGAAGGGGCCACCACACCGTATGACTACGATGATGGTGAGCCTTGTCATAA
AACCAGTGTGAAGCAAATTGGAGCTTGGATCCTGCCTCCACTCTACTCCCTGGTATTCATCTTTGGTTTT
GTGGGCAACATGTTGGTCATTATAATTCTGATAGGCTGTAAAAAGCTGAAGAGCATGACTGATATCTATC
TGCTCAACTTGGCCATCTCTGACCTGCTCTTCCTGCTCACATTACCATTCTGGGCTCACTATGCTGCAAA
TGAGTGGGTCTTTGGGAATATAATGTGTAAAGTATTCACAGGGCTCTATCACATTGGTTATTTTGGTGGA
ATCTTTTTCATTATCCTCCTGACAATTGATAGGTACTTGGCTATTGTTCATGCTGTGTTTGCTTTAAAAG
CCAGGACAGTTACCTTTGGGGTGATAACAAGTGTAGTCACTTGGGTGGTGGCTGTGTTTGCCTCTCTACC
AGGAATCATATTTACTAAATCCAAACAAGATGATCACCATTACACCTGTGGCCCTTATTTTACACAACTA
TGGAAGAATTTCCAAACAATAATGAGAAATATCTTGAGCCTGATCCTGCCTCTACTTGTCATGGTCATCT
GCTACTCAGGAATTCTCCACACCCTGTTTCGCTGTAGGAATGAGAAGAAGAGGCACAGGGCTGTGAGGCT
CATCTTTGCCATCATGATTGTCTACTTTCTCTTCTGGACTCCATACAATATTGTTCTCTTCTTGACCACC
TTCCAGGAATCCTTGGGAATGAGTAACTGTGTGATTGACAAGCACTTAGACCAGGCCATGCAGGTGACAG
AGACTCTTGGAATGACACACTGCTGCATTAATCCTGTCATTTATGCCTTTGTTGGAGAGAAGTTCCGAAG
GTATCTCTCCATATTTTTCAGAAAGCACATTGCTAAACGTCTCTGCAAACAGTGCCCAGTTTTCTATAGG
GAGACAGCAGATCGAGTGAGCTCTACATTCACTCCTTCCACTGGGGAGCAAGAGGTCTCGGTTGGGTTGT
AA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009915
Insert Size 1122 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC138803, AAI38804
RefSeq Size 2242 bp
RefSeq ORF 1122 bp
Locus ID 12772
UniProt ID P51683
Gene Summary Key functional receptor for CCL2 but can also bind CCL7 and CCL12 chemokines (PubMed:8631787, PubMed:8662823, PubMed:8996246). Its binding with CCL2 on monocytes and macrophages mediates chemotaxis and migration induction through the activation of the PI3K cascade, the small G protein Rac and lamellipodium protrusion (By similarity). Also acts as a receptor for the beta-defensin DEFB106A/DEFB106B (By similarity). Regulates the expression of T-cell inflammatory cytokines and T-cell differentiation, promoting the differentiation of T-cells into T-helper 17 cells (Th17) during inflammation (PubMed:28507030). Faciltates the export of mature thymocytes by enhancing directional movement of thymocytes to sphingosine-1-phosphate stimulation and up-regulation of S1P1R expression; signals through the JAK-STAT pathway to regulate FOXO1 activity leading to an increased expression of S1P1R (PubMed:29930553). Plays an important role in mediating peripheral nerve injury-induced neuropathic pain (PubMed:29993042). Increases NMDA-mediated synaptic transmission in both dopamine D1 and D2 receptor-containing neurons, which may be caused by MAPK/ERK-dependent phosphorylation of GRIN2B/NMDAR2B (PubMed:29993042). Mediates the recruitment of macrophages and monocytes to the injury site following brain injury (PubMed:24806994, PubMed:29632244).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...