Socs3 (NM_007707) Mouse Untagged Clone
CAT#: MC208284
Socs3 (untagged) - Mouse suppressor of cytokine signaling 3 (Socs3), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Cis3; Cish3; EF-10; Ef10; SSI-3; Ssi3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208284 representing NM_007707
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTCACCCACAGCAAGTTTCCCGCCGCCGGGATGAGCCGCCCCCTGGACACCAGCCTGCGCCTCAAGA CCTTCAGCTCCAAAAGCGAGTACCAGCTGGTGGTGAACGCCGTGCGCAAGCTGCAGGAGAGCGGATTCTA CTGGAGCGCCGTGACCGGCGGCGAGGCGAACCTGCTGCTCAGCGCCGAGCCCGCGGGCACCTTTCTTATC CGCGACAGCTCGGACCAGCGCCACTTCTTCACGTTGAGCGTCAAGACCCAGTCGGGGACCAAGAACCTAC GCATCCAGTGTGAGGGGGGCAGCTTTTCGCTGCAGAGTGACCCCCGAAGCACGCAGCCAGTTCCCCGCTT CGACTGTGTACTCAAGCTGGTGCACCACTACATGCCGCCTCCAGGGACCCCCTCCTTTTCTTTGCCACCC ACGGAACCCTCGTCCGAAGTTCCGGAGCAGCCACCTGCCCAGGCACTCCCCGGGAGTACCCCCAAGAGAG CTTACTACATCTATTCTGGGGGCGAGAAGATTCCGCTGGTACTGAGCCGACCTCTCTCCTCCAACGTGGC CACCCTCCAGCATCTTTGTCGGAAGACTGTCAACGGCCACCTGGACTCCTATGAGAAAGTGACCCAGCTG CCTGGACCCATTCGGGAGTTCCTGGATCAGTATGATGCTCCACTTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_007707 |
Insert Size | 678 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_007707.3, NP_031733.1 |
RefSeq Size | 2742 bp |
RefSeq ORF | 678 bp |
Locus ID | 12702 |
UniProt ID | O35718 |
Gene Summary | SOCS family proteins form part of a classical negative feedback system that regulates cytokine signal transduction. SOCS3 is involved in negative regulation of cytokines that signal through the JAK/STAT pathway. Inhibits cytokine signal transduction by binding to tyrosine kinase receptors including gp130, LIF, erythropoietin, insulin, IL12, GCSF and leptin receptors. Binding to JAK2 inhibits its kinase activity. Suppresses fetal liver erythropoiesis. Regulates onset and maintenance of allergic responses mediated by T-helper type 2 cells. Regulates IL-6 signaling in vivo. Probable substrate-recognition component of a SCF-like ECS (Elongin BC-CUL2/5-SOCS-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity). Seems to recognize IL6ST.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG225636 | Socs3 (tGFP-tagged) - Mouse suppressor of cytokine signaling 3 (Socs3), (10ug) |
CNY 4000.00 |
|
MR225636 | Socs3 (Myc-DDK-tagged) - Mouse suppressor of cytokine signaling 3 (Socs3) |
CNY 2400.00 |
|
MR225636L1 | Lenti ORF clone of Socs3 (Myc-DDK-tagged) - Mouse suppressor of cytokine signaling 3 (Socs3) |
CNY 4800.00 |
|
MR225636L2 | Lenti ORF clone of Socs3 (mGFP-tagged) - Mouse suppressor of cytokine signaling 3 (Socs3) |
CNY 4750.00 |
|
MR225636L3 | Lenti ORF clone of Socs3 (Myc-DDK-tagged) - Mouse suppressor of cytokine signaling 3 (Socs3) |
CNY 4750.00 |
|
MR225636L4 | Lenti ORF clone of Socs3 (mGFP-tagged) - Mouse suppressor of cytokine signaling 3 (Socs3) |
CNY 4750.00 |