Cd8a (NM_001081110) Mouse Untagged Clone

CAT#: MC208266

Cd8a (untagged) - Mouse CD8 antigen, alpha chain (Cd8a), transcript variant 1, (10ug)



  "NM_001081110" in other vectors (6)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Recombinant Anti-CD8 alpha/Lyt-2 (Clone YTS 169.4)
    • 200 ug

CNY 7170.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms BB154331; Ly-2; Ly-35; Ly-B; Lyt-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208266 representing NM_001081110
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGACCGAGACAGCGGCAGCGAGCAGGGTGGTGCGGCGCTGGGCTCGGGCGGCTCCCTAGGGCACC
CGGGCTCGGGCTCAGGCTCCGGCGGGGGCGGTGGTGGCGGCGGGGGCGGCGGCGGCAGTGGCGGCGGCGG
CGGGGCCCCGGGGGGGCTGCAGCACGAGACGCAGGAGCTGGCCTCCAAGCGGGTGGACATCCAGAACAAG
CGTTTCTACCTGGACGTGAAGCAGAACGCTAAGGGCCGTTTCCTGAAGATCGCAGAGGTGGGCGCTGGCG
GCAACAAGAGCCGCCTCACCCTCTCCATGTCTGTGGCCGTGGAGTTCCGCGACTACCTGGGCGACTTCAT
CGAGCACTACGCGCAGCTGGGCCCCAGCCAGCCACCCGACCTGGCCCAGGCACAGGACGAGCCACGCCGG
GCGCTCAAGAGCGAGTTCCTGGTGCGCGAAAACCGCAAGTACTACATGGATCTCAAGGAGAACCAGCGCG
GCCGCTTCCTGCGCATCCGCCAGACAGTCAACCGGGGGCCCGGCCTGGGCTCCACGCAGGGCCAGACCAT
TGCGCTGCCCGCACAGGGTCTCATCGAGTTCCGTGACGCTCTGGCCAAGCTCATCGACGACTATGGAGTG
GAGGAGGAGCCGGCCGAGCTGCCCGAGGGCACCTCCTTGACTGTGGACAACAAGCGCTTCTTCTTCGATG
TGGGTTCCAACAAGTACGGCGTGTTTATGCGAGTGAGTGAGGTGAAGCCCACCTACCGCAACTCCATCAC
CGTGCCCTACAAGGTGTGGGCCAAGTTCGGACACACCTTCTGCAAGTACTCCGAGGAGATGAAGAAGATT
CAAGAGAAACAGAGGGAGAAGCGGGCCGCTTGTGAGCAGCTCCACCAGCAGCAACAGCAGCAGCAAGAGG
AGACCACCGCTGCCACCCTGCTACTGCAGGGCGAGGAAGAAGGGGAAGAAGATTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001081110
Insert Size 966 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001081110.2, NP_001074579.1
RefSeq Size 3130 bp
RefSeq ORF 744 bp
Locus ID 12525
UniProt ID P01731
Gene Summary Integral membrane glycoprotein that plays an essential role in the immune response and serves multiple functions in responses against both external and internal offenses. In T-cells, functions primarily as a coreceptor for MHC class I molecule:peptide complex. The antigens presented by class I peptides are derived from cytosolic proteins while class II derived from extracellular proteins. Interacts simultaneously with the T-cell receptor (TCR) and the MHC class I proteins presented by antigen presenting cells (APCs). In turn, recruits the Src kinase LCK to the vicinity of the TCR-CD3 complex. LCK then initiates different intracellular signaling pathways by phosphorylating various substrates ultimately leading to lymphokine production, motility, adhesion and activation of cytotoxic T-lymphocytes (CTLs). This mechanism enables CTLs to recognize and eliminate infected cells and tumor cells. In NK-cells, the presence of CD8A homodimers at the cell surface provides a survival mechanism allowing conjugation and lysis of multiple target cells. CD8A homodimer molecules also promote the survival and differentiation of activated lymphocytes into memory CD8 T-cells.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...