Ccng1 (NM_009831) Mouse Untagged Clone
CAT#: MC208230
Ccng1 (untagged) - Mouse cyclin G1 (Ccng1), (10ug)
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI314029 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208230 representing NM_009831
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_009831 |
Insert Size | 885 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_009831.2, NP_033961.1 |
RefSeq Size | 3501 bp |
RefSeq ORF | 885 bp |
Locus ID | 12450 |
UniProt ID | P51945 |
Gene Summary | May play a role in growth regulation. Is associated with G2/M phase arrest in response to DNA damage. May be an intermediate by which p53 mediates its role as an inhibitor of cellular proliferation.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222139 | Ccng1 (tGFP-tagged) - Mouse cyclin G1 (Ccng1), (10ug) |
CNY 3230.00 |
|
MR222139 | Ccng1 (Myc-DDK-tagged) - Mouse cyclin G1 (Ccng1) |
CNY 2950.00 |
|
MR222139L3 | Lenti ORF clone of Ccng1 (Myc-DDK-tagged) - Mouse cyclin G1 (Ccng1) |
CNY 4850.00 |
|
MR222139L4 | Lenti ORF clone of Ccng1 (mGFP-tagged) - Mouse cyclin G1 (Ccng1) |
CNY 4850.00 |