Btg3 (NM_009770) Mouse Untagged Clone
CAT#: MC208204
Btg3 (untagged) - Mouse B-cell translocation gene 3 (Btg3), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | ANA; tob; tob5 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208204 representing NM_009770
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGAACGAAATTGCGGCTGTTGTCTTCTTTTTCACAAGGCTAGTTCGAAAGCATGACAAGTTGAAAA AAGAAGCAGTTGAGAGGTTTGCTGAGAAATTAACTCAAATACTTCAAGAGAAATATAAAAATCACTGGTA TCCAGAAAAACCATCCAAAGGTCAGGCCTACAGATGCATTCGTGTCAATAAGTTTCAGAGAGTTGATCCC GATGTCCTGAAAGCCTGTGAGAACAGCTGCATCTTGTACAGCGACCTGGGCTTGCCTAAGGAGCTTACAC TCTGGGTGGATCCGTGTGAGGTGTGCTGCCGGTATGGAGAGAAAAACAATGCGTTCATTGTTGCCAGCTT TGAAAATGAGGACGAGAACAAGGATGAAATCTCCAAGAAAGTTAGCAGGGCTCTGGATAAGGTGACCTCT GATTATCACTCAGGGTCCTCTTCCTCAGATGAAGACACAAGCAAGGAAGTGGACGTGAAACCCAGCTCAG TGGCGGCAACACCAAGCCCCGTGTACCAGATTTCAGAACTGATATTCCCACCTCTTCCAATGTGGCACCC TTTGCCCAGAAAAAAGCCAGGAATGTATCGAGGGAGCGGCCATCAGACTCACTACCCTCCTCCTGTTCCA TTTGCTTATCCAAATCCAGGAAGGAAGAATAAACCATTCCGCCCAATTCCAGTGACATGGGTACCTCCTC CTGGAATGCATTGTGACCGAAATCACTGGATTAATCCTCACATGTTAGCACCTCACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_009770 |
| Insert Size | 759 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_009770.3, NP_033900.1 |
| RefSeq Size | 1414 bp |
| RefSeq ORF | 759 bp |
| Locus ID | 12228 |
| UniProt ID | P50615 |
| Gene Summary | This gene encodes B cell translocation gene 3, a member of the BTG gene family. This family is defined by a conserved N-terminal domain, known to bind transcription factors, and a less conserved C-terminal domain. This protein is thought to have anti-proliferative properties, and may be involved in regulating the G1-S transition to suppress cell cycle progression. Mice deficient for this gene display an increased incidence of lung cancers, and many human lung cancer cells exhibit decreased levels of B cell translocation gene 3. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 17. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR203216 | Btg3 (Myc-DDK-tagged) - Mouse B-cell translocation gene 3 (Btg3) |
CNY 2400.00 |
|
| MR203216L3 | Lenti ORF clone of Btg3 (Myc-DDK-tagged) - Mouse B-cell translocation gene 3 (Btg3) |
CNY 4750.00 |
|
| MR203216L4 | Lenti ORF clone of Btg3 (mGFP-tagged) - Mouse B-cell translocation gene 3 (Btg3) |
CNY 4750.00 |
