Btc (NM_007568) Mouse Untagged Clone
CAT#: MC208202
Btc (untagged) - Mouse betacellulin, epidermal growth factor family member (Btc), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Bcn |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208202 representing NM_007568
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACCCAACAGCCCCGGGTAGCAGTGTCAGCTCCCTGCCGCTGCTCCTGGTCCTTGCCCTGGGTCTTG CAATTCTCCACTGTGTGGTAGCAGATGGGAACACAACCAGAACACCAGAAACCAATGGCTCTCTTTGTGG AGCTCCTGGGGAAAACTGCACAGGTACCACCCCTAGACAGAAAGTGAAAACCCACTTCTCTCGGTGCCCC AAGCAGTACAAGCATTACTGCATCCATGGGAGATGCCGCTTCGTGGTGGACGAGCAAACTCCCTCCTGCA TCTGTGAGAAAGGCTACTTTGGGGCTCGGTGTGAGCGAGTGGACCTGTTTTACCTCCAGCAGGACCGGGG GCAGATCCTGGTGGTCTGCTTGATAGTGGTCATGGTGGTGTTCATCATTTTAGTCATCGGCGTCTGCACC TGCTGTCATCCTCTTCGGAAACATCGTAAAAAAAAGAAGGAAGAGAAAATGGAGACTTTGGATAAAGATA AAACTCCCATAAGTGAAGATATTCAAGAGACCAATATTGCTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_007568 |
| Insert Size | 534 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_007568.5, NP_031594.1 |
| RefSeq Size | 2876 bp |
| RefSeq ORF | 534 bp |
| Locus ID | 12223 |
| UniProt ID | Q05928 |
| Gene Summary | This gene encodes a member of the epidermal growth factor (EGF) family. These growth factors are ligands for the EGFR/ErbB receptor tyrosine kinases, and play roles in cell growth and differentiation. The encoded protein is synthesized as a transmembrane precursor that is proteolytically cleaved to generate a mature peptide, and plays a role in the differentiation of pancreatic beta cells. This gene may also play a protective role in acute pancreatitis, whereas increased expression of this gene may contribute to diabetic macular edema. Gene therapy using combinations of this gene and other pancreas-specific transcription factors may induce islet neogenesis and remediate hyperglycemia in type 1 diabetes. [provided by RefSeq, Apr 2011] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG221004 | Btc (tGFP-tagged) - Mouse betacellulin epidermal growth factor family member (Btc), (10ug) |
CNY 2850.00 |
|
| MR221004 | Btc (Myc-DDK-tagged) - Mouse betacellulin, epidermal growth factor family member (Btc) |
CNY 2400.00 |
|
| MR221004L3 | Lenti ORF clone of Btc (Myc-DDK-tagged) - Mouse betacellulin, epidermal growth factor family member (Btc) |
CNY 4750.00 |
|
| MR221004L4 | Lenti ORF clone of Btc (mGFP-tagged) - Mouse betacellulin, epidermal growth factor family member (Btc) |
CNY 4750.00 |
