Bcl2l11 (NM_009754) Mouse Untagged Clone
CAT#: MC208191
Bcl2l11 (untagged) - Mouse BCL2-like 11 (apoptosis facilitator) (Bcl2l11), transcript variant 3, (10ug)
CNY 1200.00
CNY 3990.00
Cited in 1 publication. |
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1500006F24Rik; bcl2-L-11; Bim; Bod |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NM_009754.3
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCAAGCAACCTTCTGATGTAAGTTCTGAGTGTGACAGAGAAGGTGGACAATTGCAGCCTGCTGAGA GGCCTCCCCAGCTCAGGCCTGGGGCCCCTACCTCCCTACAGACAGAACCGCAAGCTTCCATACGACAGTC TCAGGAGGAACCTGAAGATCTGCGCCCGGAGATACGGATTGCACAGGAGCTGCGGCGGATCGGAGACGAG TTCAACGAAACTTACACAAGGAGGGTGTTTGCAAATGATTACCGCGAGGCTGAAGACCACCCTCAAATGG TTATCTTACAACTGTTACGCTTTATCTTCCGTCTGGTATGGAGAAGGCATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_009754 |
Insert Size | 333 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_009754.3, NP_033884.1 |
RefSeq Size | 4782 bp |
RefSeq ORF | 333 bp |
Locus ID | 12125 |
UniProt ID | O54918 |
Gene Summary | Induces apoptosis and anoikis. The isoforms vary in cytotoxicity with isoform BimS being the most potent and isoform BimEL being the least potent.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) uses an alternate in-frame splice site in the central coding region, compared to variant 1, resulting in an isoform (3) that is shorter than isoform 1. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Targeting folate receptor β positive tumor-associated macrophages in lung cancer with a folate-modified liposomal complex
,Tie, Y;Zheng, H;He, Z;Yang, J;Shao, B;Liu, L;Luo, M;Yuan, X;Liu, Y;Zhang, X;Li, H;Wu, M;Wei, X;,
Signal Transduct Target Ther
,PubMed ID 31993222
[BCL2L11]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223081 | Bcl2l11 (tGFP-tagged) - Mouse BCL2-like 11 (apoptosis facilitator) (Bcl2l11) transcript variant 3, (10ug) |
CNY 2850.00 |
|
MR223081 | Bcl2l11 (Myc-DDK-tagged) - Mouse BCL2-like 11 (apoptosis facilitator) (Bcl2l11), transcript variant 3 |
CNY 1200.00 |
|
MR223081L3 | Lenti ORF clone of Bcl2l11 (Myc-DDK-tagged) - Mouse BCL2-like 11 (apoptosis facilitator) (Bcl2l11), transcript variant 3 |
CNY 4750.00 |
|
MR223081L4 | Lenti ORF clone of Bcl2l11 (mGFP-tagged) - Mouse BCL2-like 11 (apoptosis facilitator) (Bcl2l11), transcript variant 3 |
CNY 4750.00 |
其它Bcl2l11产品