Artn (NM_009711) Mouse Untagged Clone
CAT#: MC208157
Artn (untagged) - Mouse artemin (Artn), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | neub; neublastin |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208157 representing NM_009711
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAACTGGGACTTGCAGAGCCTACTGCATTGTCCCACTGCCTCCGGCCTAGGTGGCAGTCAGCCTGGT GGCCAACCCTAGCTGTTCTAGCCCTGCTGAGCTGCGTCACAGAAGCTTCCCTGGACCCAATGTCCCGCAG CCCCGCCGCTCGCGACGGTCCCTCACCGGTCTTGGCGCCCCCCACGGACCACCTGCCTGGGGGACACACT GCGCATTTGTGCAGCGAAAGAACCCTGCGACCCCCGCCTCAGTCTCCTCAGCCCGCACCCCCGCCGCCTG GTCCCGCGCTCCAGTCTCCTCCCGCTGCGCTCCGCGGGGCACGCGCGGCGCGTGCAGGAACCCGGAGCAG CCGCGCACGGACCACAGATGCGCGCGGCTGCCGCCTGCGCTCGCAGCTGGTGCCGGTGAGTGCGCTCGGC CTAGGCCACAGCTCCGACGAGCTGATACGTTTCCGCTTCTGCAGCGGCTCGTGCCGCCGAGCACGCTCCC AGCACGATCTCAGTCTGGCCAGCCTACTGGGCGCTGGGGCCCTACGGTCGCCTCCCGGGTCCCGGCCGAT CAGCCAGCCCTGCTGCCGGCCCACTCGCTATGAGGCCGTCTCCTTCATGGACGTGAACAGCACCTGGAGG ACCGTGGACCACCTCTCCGCCACTGCCTGCGGCTGTCTGGGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_009711 |
| Insert Size | 675 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_009711.4, NP_033841.1 |
| RefSeq Size | 2179 bp |
| RefSeq ORF | 675 bp |
| Locus ID | 11876 |
| UniProt ID | Q9Z0L2 |
| Gene Summary | This gene encodes a secreted ligand of the glial cell line-derived neurotrophic factor (GDNF) subfamily and TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein signals through the RET receptor and GFR alpha 3 coreceptor, and supports the survival of a number of peripheral neuron populations and at least one population of dopaminergic CNS neurons. Mice lacking a functional copy of this gene exhibit ptosis and impaired development of the sympathetic nervous system. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same protein (isoform 1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG223414 | Artn (tGFP-tagged) - Mouse artemin (Artn), (10ug) |
CNY 2850.00 |
|
| MR223414 | Artn (Myc-DDK-tagged) - Mouse artemin (Artn) |
CNY 2400.00 |
|
| MR223414L3 | Lenti ORF clone of Artn (Myc-DDK-tagged) - Mouse artemin (Artn) |
CNY 4750.00 |
|
| MR223414L4 | Lenti ORF clone of Artn (mGFP-tagged) - Mouse artemin (Artn) |
CNY 4750.00 |
