Ifi27l2a (NM_029803) Mouse Untagged Clone
CAT#: MC208074
Ifi27l2a (untagged) - Mouse interferon, alpha-inducible protein 27 like 2A (Ifi27l2a), (10ug)
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2310061N23Rik; Ifi27; Isg12; Isg12(b1) |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208074 representing NM_029803
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTGGGAACACTGTTTGGCTCTGCCATAGGAGGAGCTCTGGCCGTGGCAGGGGCACCTGTGGCCCTGG CTGCCATGGGCTTCACTGGGACAGGCATTGCAGCTGCCTCCATAGCAGCCAAGATGATGTCTGCTGCAGC AATTGCCAATGGAGGTGGAGTTGCAGCAGGAAGCCTGGTAGCCACACTCCAATCAGCAGGGGTCCTTGGA CTCTCCACATCAACAAATGCCATCCTAGGGGCTGCTGGGGCAGCTGTTGGAGCCTTGCTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_029803 |
Insert Size | 273 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC100588, AAI00589 |
RefSeq Size | 540 bp |
RefSeq ORF | 273 bp |
Locus ID | 76933 |
UniProt ID | Q8R412 |
Gene Summary | May be involved in the interferon-induced negative regulation of the transcriptional activity of NR4A1, NR4A2 and NR4A3 through the enhancement of XPO1-mediated nuclear export of these nuclear receptors (PubMed:22427340). Through the regulation of NR4A1 transcriptional activity, may play a role in the vascular response to injury (PubMed:22427340).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the shorter transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG215403 | Ifi27l2a (tGFP-tagged) - Mouse interferon alpha-inducible protein 27 like 2A (Ifi27l2a), (10ug) |
CNY 2850.00 |
|
MR215403 | Ifi27l2a (Myc-DDK-tagged) - Mouse interferon, alpha-inducible protein 27 like 2A (Ifi27l2a) |
CNY 1200.00 |
|
MR215403L3 | Lenti ORF clone of Ifi27l2a (Myc-DDK-tagged) - Mouse interferon, alpha-inducible protein 27 like 2A (Ifi27l2a) |
CNY 4750.00 |
|
MR215403L4 | Lenti ORF clone of Ifi27l2a (mGFP-tagged) - Mouse interferon, alpha-inducible protein 27 like 2A (Ifi27l2a) |
CNY 4750.00 |
其它Ifi27l2a产品