Snx12 (NM_018875) Mouse Untagged Clone
CAT#: MC208057
Snx12 (untagged) - Mouse sorting nexin 12 (Snx12), transcript variant 3, (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2610001F05Rik; AW045757; SDP8 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208057 representing NM_018875
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCGGACACCGCAGTGGCTGACACTAGGCGCCTTAACTCGAAGCCCCAAGACCTGACCGACGCTTACG GGCCGCCCAGTAACTTCCTGGAGATAGACATCTTTAATCCACAGACGGTGGGCGTGGGCCGCGCGCGCTT CACCACCTATGAGGTTCGCATGCGGACAAACCTACCCATCTTCAAGCTGAAAGAATCCTGTGTACGGCGA CGCTATAGTGACTTTGAGTGGCTGAAAAATGAGCTGGAGCGAGATAGTAAGATCGTAGTACCACCACTGC CTGGGAAAGCCTTGAAGCGGCAGCTCCCTTTCCGAGGAGATGAAGGGATCTTTGAGGAGTCTTTCATTGA AGAAAGGAGGCAAGGCCTCGAACAGTTTATTAACAAAATTGCTGGGCACCCACTGGCTCAGAATGAACGC TGTCTACACATGTTCCTGCAGGAGGAGGCAATTGATAGGAACTACGTCCCTGGGAAGGTCCTTGGGGAAA AGGATTGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_018875 |
| Insert Size | 501 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_018875.2, NP_061363.2 |
| RefSeq Size | 1000 bp |
| RefSeq ORF | 501 bp |
| Locus ID | 55988 |
| UniProt ID | O70493 |
| Gene Summary | May be involved in several stages of intracellular trafficking.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 3' coding region and UTR, compared to variant 1. It encodes isoform 3 which has a longer, distinct C-terminus, compared to isoform 1. An in-frame AUG is located 45 codons upstream of the annotated translation start site but is not being annotated as a start site since it is not conserved and is in a weak Kozak sequence context. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201338 | Snx12 (tGFP-tagged) - Mouse sorting nexin 12 (Snx12) |
CNY 2850.00 |
|
| MR201338 | Snx12 (Myc-DDK-tagged) - Mouse sorting nexin 12 (Snx12), transcript variant 3 |
CNY 2400.00 |
|
| MR201338L3 | Lenti ORF clone of Snx12 (Myc-DDK-tagged) - Mouse sorting nexin 12 (Snx12), transcript variant 3 |
CNY 4750.00 |
|
| MR201338L4 | Lenti ORF clone of Snx12 (mGFP-tagged) - Mouse sorting nexin 12 (Snx12), transcript variant 3 |
CNY 4750.00 |
