United States
Germany
Japan
United Kingdom
China
Hbegf (NM_010415) Mouse Untagged Clone
CAT＃: MC208020
Hbegf (untagged) - Mouse heparin-binding EGF-like growth factor (Hbegf), (10ug)
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AW047313; Dtr; Dts; Hegfl |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208020 representing NM_010415
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGCTGCTGCCGTCGGTGATGCTGAAGCTCTTTCTGGCCGCAGTGTTGTCCGCGTTGGTGACCGGTG AGAGTCTGGAGCGGCTTCGGAGAGGTCTGGCGGCAGCAACCAGCAACCCTGACCCTCCCACTGGATCCAC AAACCAGCTGCTACCCACGGGAGGTGATCGTGCTCAGGGGGTCCAGGACTTGGAAGGGACAGATCTGAAC CTTTTCAAAGTTGCTTTCTCCTCCAAGCCACAAGGCCTGGCCACCCCAAGCAAAGAAAGGAATGGGAAAA AGAAGAAGAAAGGAAAGGGGTTAGGGAAGAAGAGAGACCCATGCCTCAGGAAATACAAGGACTACTGCAT CCACGGGGAGTGCAGATACCTGCAGGAGTTCCGTACTCCCTCTTGCAAATGCCTCCCTGGTTACCACGGA CACAGGTGTCATGGGCTGACTCTACCAGTGGAGAATCCCCTATACACATATGACCACACTACAGTCTTGG CTGTGGTGGCTGTAGTACTGTCGTCCGTCTGTCTTCTTGTCATCGTGGGACTTCTCATGTTTAGGTACCA CAGGAGAGGAGGTTATGACTTGGAAAGTGAAGAGAAAGTGAAGTTGGGCGTGGCTAGCTCCCACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_010415 |
| Insert Size | 627 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_010415.1, NP_034545.1 |
| RefSeq Size | 2337 bp |
| RefSeq ORF | 627 bp |
| Locus ID | 15200 |
| UniProt ID | Q06186 |
| Gene Summary | Growth factor that mediates its effects via EGFR, ERBB2 and ERBB4. Required for normal cardiac valve formation and normal heart function. Promotes smooth muscle cell proliferation. May be involved in macrophage-mediated cellular proliferation. It is mitogenic for fibroblasts, but not endothelial cells. It is able to bind EGF receptor/EGFR with higher affinity than EGF itself and is a far more potent mitogen for smooth muscle cells than EGF. Also acts as a diphtheria toxin receptor.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR212137 | Hbegf (Myc-DDK-tagged) - Mouse heparin-binding EGF-like growth factor (Hbegf) |
CNY 3,600.00 |
|
| MR212137L1 | Lenti ORF clone of Hbegf (Myc-DDK-tagged) - Mouse heparin-binding EGF-like growth factor (Hbegf) |
CNY 6,000.00 |
|
| MR212137L2 | Lenti ORF clone of Hbegf (mGFP-tagged) - Mouse heparin-binding EGF-like growth factor (Hbegf) |
CNY 5,890.00 |
|
| MR212137L3 | Lenti ORF clone of Hbegf (Myc-DDK-tagged) - Mouse heparin-binding EGF-like growth factor (Hbegf) |
CNY 6,000.00 |
|
| MR212137L4 | Lenti ORF clone of Hbegf (mGFP-tagged) - Mouse heparin-binding EGF-like growth factor (Hbegf) |
CNY 6,000.00 |
