Endov (NM_177394) Mouse Untagged Clone
CAT＃: MC207963
Endov (untagged) - Mouse RIKEN cDNA A730011L01 gene (A730011L01Rik), transcript variant 2, (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | A730011L01Rik |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207963 representing NM_177394
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTTGGCCTGAAGGCCCCCTATGTGTCAGGCTTCCTGGCCTTCCGAGAGGTCCCTTTCCTGGTGGAGT TGGTACAGCGGCTGCAAGAGAAGGAACCAGATCTCATGCCCCAGGTCGTTCTTGTGGATGGAAACGGGGT GCTTCACCAACGAGGCTTCGGGGTGGCCTGCCACCTTGGTGTCCTTACAGAGCTGCCATGCATCGGGGTG GCCAAGAAGCTCCTGCAGGTGGATGGACTGGAGAACAATGCTCTGCACAAGGAGAAGATTGTGCTCCTGC AGGCCGGAGGAGACACATTTCCTCTGATAGGCAGCTCTGGGACTGTCCTGGGAATGGCCCTGAGGAGCCA TGACCACAGCACCAAGCCCCTCTATGTCTCTGTGGGCCACAGAATAAGCCTGGAGGTCGCTGTGCGCCTC ACCCACCACTGCTGTAGGTTCCGGATCCCAGAACCTATACGCCAGGCTGACATCCGCTCTCGAGAGTACA TCCGAAGGACTCTAGGGCAGCTTGGGGTGGCTCCTGCACAGAGAAAGGACAGGAGCCAGAAAGAGCAGAG GCCAAATGCATGCCCCCAAGGAGGCCCAGGAGCACTTGCAGATCAAGGCAGGCCTCCTGAATGCGACGGC AGAGACTCCAGCTCAGACCGGAAAGCCCCCGAGCCAGGCTTCCAGGAGCAGAAGGACCAGCAGTTGGAGG GAACCGGGCATCAGGAAGACTCGGACCTCTGGCCTCCTTCTCCAGCCTGGGTACAGTCACCACCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_177394 |
| Insert Size | 768 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_177394.3, NP_796368.1 |
| RefSeq Size | 5164 bp |
| RefSeq ORF | 768 bp |
| Locus ID | 338371 |
| UniProt ID | Q8C9A2 |
| Gene Summary | Endoribonuclease that specifically cleaves inosine-containing RNAs: cleaves RNA at the second phosphodiester bond 3' to inosine. Has strong preference for single-stranded RNAs (ssRNAs) toward double-stranded RNAs (dsRNAs). Cleaves mRNAs and tRNAs containing inosine. Also able to cleave structure-specific dsRNA substrates containing the specific sites 5'-IIUI-3' and 5'-UIUU-3'. Inosine is present in a number of RNAs following editing; the function of inosine-specific endoribonuclease is still unclear: it could either play a regulatory role in edited RNAs, or be involved in antiviral response by removing the hyperedited long viral dsRNA genome that has undergone A-to-I editing. Binds branched DNA structures (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) represents an alternate 5' splice pattern and uses a downstream start codon, compared to variant 1. Isoform 2 has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG203286 | Endov (tGFP-tagged) - Mouse RIKEN cDNA A730011L01 gene (A730011L01Rik) |
CNY 2850.00 |
|
| MR203286 | Endov (Myc-DDK-tagged) - Mouse RIKEN cDNA A730011L01 gene (A730011L01Rik), transcript variant 2 |
CNY 2400.00 |
|
| MR203286L3 | Lenti ORF clone of Endov (Myc-DDK-tagged) - Mouse RIKEN cDNA A730011L01 gene (A730011L01Rik), transcript variant 2 |
CNY 4750.00 |
|
| MR203286L4 | Lenti ORF clone of Endov (mGFP-tagged) - Mouse RIKEN cDNA A730011L01 gene (A730011L01Rik), transcript variant 2 |
CNY 4750.00 |
