Qrfp (NM_183424) Mouse Untagged Clone
CAT＃: MC207900
Qrfp (untagged) - Mouse pyroglutamylated RFamide peptide (Qrfp), (10ug)
CNY 1200.00
CNY 3990.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | P51; P518; QR |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207900 representing NM_183424
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGGGGCTTCCGGCCTTTGCTTTCCCTACTTCTCCCTCTGAGTGCCTGCTTTCCCCTGCTGGACAGAA GGGGACCCACAGACATCGGTGACATCGGAGCCAGGATGAGCTGGGCCCAGCTGGCTGAGGGACACCCCCC CAACTCGGTTCAAAATCCACAGCCACAGGCCCTGCTTGTGGTGGCCAAGGAGCAGCAGGCCTCCCACAGG GAGCACACCGGCTTCCGTCTAGGGAGGCAAGACGGTAGCAGTGAGGCCGCAGGGTTCCTGCCCGCCGACT CGGAGAAGGCCAGCGGCCCTCTGGGGACTCTGGCAGAGGAGCTGAGCAGCTACAGCCGGAGGAAGGGAGG CTTCAGCTTCCGCTTTGGACGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_183424 |
| Insert Size | 375 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC094274, AAH94274 |
| RefSeq Size | 889 bp |
| RefSeq ORF | 375 bp |
| Locus ID | 227717 |
| UniProt ID | Q8CE23 |
| Gene Summary | This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products. The encoded products are members of the RFamide family of neuropeptides, characterized by their common protein C-terminus consisting of an arginine (R) and an amidated phenylalanine (F). These products include the neuropeptides QRFP-26 (26RFa) and the N-terminally extended form, QRFP-43 (43RFa). Both of these neuropeptides bind to the pyroglutamylated RFamide peptide receptor (QRFPR) and may regulate blood pressure, reproduction and food intake. [provided by RefSeq, Sep 2015] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Pyroglutamylated RF-amide peptide (QRFP) gene is regulated by metabolic endotoxemia
,Jossart, C;Mulumba, M;Granata, R;Gallo, D;Ghigo, E;Marleau, S;Servant, MJ;Ong, H;,
Mol. Endocrinol.
,PubMed ID 24284825
[QRFP]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200640 | Qrfp (tGFP-tagged) - Mouse cDNA sequence BC094274 (BC094274) |
CNY 2850.00 |
|
| MR200640 | Qrfp (Myc-DDK-tagged) - Mouse pyroglutamylated RFamide peptide (Qrfp) |
CNY 1200.00 |
|
| MR200640L3 | Lenti ORF clone of Qrfp (Myc-DDK-tagged) - Mouse pyroglutamylated RFamide peptide (Qrfp) |
CNY 4750.00 |
|
| MR200640L4 | Lenti ORF clone of Qrfp (mGFP-tagged) - Mouse pyroglutamylated RFamide peptide (Qrfp) |
CNY 4750.00 |
