Egln1 (NM_053207) Mouse Untagged Clone

CAT#: MC207840

Egln1 (untagged) - Mouse EGL nine homolog 1 (C. elegans) (Egln1), (10ug)



  "NM_053207" in other vectors (4)

CNY 1800.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI503754; C1orf12; Hif-p4h-2; HIF-PH2; HPH-2; ORF13; Phd2; SM-20
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207840 representing NM_053207
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTTGCTTGTTACCCAGGCAACGGAACAGGCTATGTCCGTCACGTTGATAACCCAAATGGAGATGGAA
GATGCGTGACATGTATATATTATCTAAATAAAGACTGGGACGCCAAGGTAAGTGGAGGTATTCTTCGAAT
TTTTCCAGAAGGCAAAGCCCAGTTTGCTGACATTGAACCCAAATTTGATAGACTGCTGTTTTTCTGGTCT
GACCGGCGTAACCCTCATGAAGTACAGCCAGCATACGCCACAAGGTACGCAATAACTGTTTGGTATTTTG
ATGCAGATGAGCGAGCGAGAGCTAAAGTAAAATATCTAACAGGTGAGAAAGGTGTGAGGGTTGAACTCAA
GCCCAATTCAGTCAGCAAAGACGTCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_053207
Insert Size 378 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_053207.2, NP_444437.2
RefSeq Size 3524 bp
RefSeq ORF 1203 bp
Locus ID 112405
UniProt ID Q91YE3
Gene Summary Cellular oxygen sensor that catalyzes, under normoxic conditions, the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. Hydroxylates a specific proline found in each of the oxygen-dependent degradation (ODD) domains (N-terminal, NODD, and C-terminal, CODD) of HIF1A. Also hydroxylates HIF2A. Has a preference for the CODD site for both HIF1A and HIF1B. Hydroxylated HIFs are then targeted for proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Under hypoxic conditions, the hydroxylation reaction is attenuated allowing HIFs to escape degradation resulting in their translocation to the nucleus, heterodimerization with HIF1B, and increased expression of hypoxy-inducible genes. EGLN1 is the most important isozyme under normoxia and, through regulating the stability of HIF1, involved in various hypoxia-influenced processes such as angiogenesis in retinal and cardiac functionality. Target proteins are preferentially recognized via a LXXLAP motif.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...