Polr2i (NM_027259) Mouse Untagged Clone
CAT#: MC207690
Polr2i (untagged) - Mouse polymerase (RNA) II (DNA directed) polypeptide I (Polr2i), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2810002B19Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207690 representing NM_027259
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAACCCGACGGGACGTACGAGCCTGGCTTCGTGGGTATTCGGTTCTGCCAGGAATGTAATAACATGC TGTACCCCAAGGAGGACAAGGAAAATCGCATTCTGCTGTACGCGTGCCGGAATTGCGATTACCAGCAGGA AGCCGACAACAGCTGCATCTACGTCAACAAAATCACGCACGAAGTGGACGAGCTGACCCAGATCATCGCA GACGTGTCCCAGGACCCCACGTTGCCCCGGACGGAGGACCACCCGTGCCAGAAGTGTGGCCACAAGGAGG CAGTGTTCTTTCAGTCACACAGTGCCCGAGCTGAGGACGCCATGCGCCTGTACTATGTTTGCACTGCCCC ACACTGCGGCCACCGCTGGACTGAGTGA AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC TGGATTACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_027259 |
Insert Size | 378 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_027259.1, NP_081535.1 |
RefSeq Size | 707 bp |
RefSeq ORF | 378 bp |
Locus ID | 69920 |
UniProt ID | P60898 |
Gene Summary | DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Component of RNA polymerase II which synthesizes mRNA precursors and many functional non-coding RNAs. Pol II is the central component of the basal RNA polymerase II transcription machinery. It is composed of mobile elements that move relative to each other. RPB9 is part of the upper jaw surrounding the central large cleft and thought to grab the incoming DNA template (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200650 | Polr2i (tGFP-tagged) - Mouse polymerase (RNA) II (DNA directed) polypeptide I (Polr2i) |
CNY 2850.00 |
|
MR200650 | Polr2i (Myc-DDK-tagged) - Mouse polymerase (RNA) II (DNA directed) polypeptide I (Polr2i) |
CNY 1200.00 |
|
MR200650L3 | Lenti ORF clone of Polr2i (Myc-DDK-tagged) - Mouse polymerase (RNA) II (DNA directed) polypeptide I (Polr2i) |
CNY 4750.00 |
|
MR200650L4 | Lenti ORF clone of Polr2i (mGFP-tagged) - Mouse polymerase (RNA) II (DNA directed) polypeptide I (Polr2i) |
CNY 4750.00 |