Pcgf1 (NM_197992) Mouse Untagged Clone
CAT#: MC207688
Pcgf1 (untagged) - Mouse polycomb group ring finger 1 (Pcgf1), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2010002K04Rik; AU024121; Nspc1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207688 representing NM_197992
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGGCTTCGGAACCAGCTCCAGTCAGTGTACAAGATGGACCCACTACGGAACGAGGAGGAGGTCCGGG TGAAGATCAAAGACCTGAATGAACACATCGTTTGCTGCCTGTGCGCGGGCTACTTCGTGGATGCCACCAC CATCACAGAGTGTCTCCACACCTTCTGCAAAAGTTGTATCGTGAAGTACCTGCAAACCAGCAAGTACTGC CCCATGTGCAACATCAAGATCCACGAGACGCAGCCGTTGCTCAATCTCAAACTGGATCGGGTCATGCAGG ACATAGTGTATAAGCTAGTGCCAGGCTTGCAAGACAGTGAAGAGAAACGGATTCGGGAATTCTATCAGTC CCGAGGCTTAGACAGAGTCTCCCAGCCCAGTGGTGAAGAGCCAGCCCTGAGCAACCTTGGCCTCCCCTTC AGCAGTTTTGACCACTCTAAAGCCCACTATTATCGATATGATGAACAGCTGAGCCTATGCCTGGAGCGGC TGAGTTCTGGCAAAGACAAGAATAAAAATGTCCTTCAGAACAAGTATGTTCGGTGTTCTGTGAGAGCTGA GGTCCGCCATCTCCGAAGGGTTCTGTGTCACCGACTAATGCTAAATCCACAGCATGTACAGCTCCTTTTT GACAATGAGGTTCTCCCAGATCACATGACAATGAAACAGCTATGGCTGTCCCGCTGGTTCGGCAAGCCAT CTCCTTTGCTTCTCCAATACAGTGTGAAAGAGAAGAGGAGGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_197992 |
Insert Size | 744 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_197992.1, NP_932109.1 |
RefSeq Size | 908 bp |
RefSeq ORF | 744 bp |
Locus ID | 69837 |
UniProt ID | Q8R023 |
Gene Summary | Component of the Polycomb group (PcG) multiprotein BCOR complex, a complex required to maintain the transcriptionally repressive state of some genes, such as BCL6 and the cyclin-dependent kinase inhibitor, CDKN1A. Transcriptional repressor that may be targeted to the DNA by BCL6; this transcription repressor activity may be related to PKC signaling pathway. Represses CDKN1A expression by binding to its promoter, and this repression is dependent on the retinoic acid response element (RARE element). Promotes cell cycle progression and enhances cell proliferation as well. May have a positive role in tumor cell growth by down-regulating CDKN1A. Component of a Polycomb group (PcG) multiprotein PRC1-like complex, a complex class required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. PcG PRC1 complex acts via chromatin remodeling and modification of histones; it mediates monoubiquitination of histone H2A 'Lys-119', rendering chromatin heritably changed in its expressibility. Within the PRC1-like complex, regulates RNF2 ubiquitin ligase activity. Regulates the expression of DPPA4 and NANOG in the NT2 embryonic carcinoma cells.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203127 | Pcgf1 (tGFP-tagged) - Mouse polycomb group ring finger 1 (Pcgf1) |
CNY 4000.00 |
|
MR203127 | Pcgf1 (Myc-DDK-tagged) - Mouse polycomb group ring finger 1 (Pcgf1) |
CNY 2400.00 |
|
MR203127L3 | Lenti ORF clone of Pcgf1 (Myc-DDK-tagged) - Mouse polycomb group ring finger 1 (Pcgf1) |
CNY 4750.00 |
|
MR203127L4 | Lenti ORF clone of Pcgf1 (mGFP-tagged) - Mouse polycomb group ring finger 1 (Pcgf1) |
CNY 4750.00 |