Nrgn (NM_022029) Mouse Untagged Clone
CAT#: MC207547
Nrgn (untagged) - Mouse neurogranin (Nrgn), (10ug)
CNY 1800.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 0710001B06Rik; AI838505; NG; NG/RC3; Pss1; R75334; RC3 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207547 representing NM_022029
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACTGCTGCACGGAGAGCGCCTGCTCCAAGCCAGACGACGATATTCTTGACATCCCGCTGGATGATC CCGGAGCCAACGCCGCTGCAGCCAAAATCCAGGCGAGTTTCCGGGGCCACATGGCGAGGAAGAAGATAAA GAGCGGAGAGTGTGGCCGGAAGGGACCGGGCCCCGGGGGACCAGGCGGAGCTGGGGGCGCCCGGGGAGGC GCGGGCGGCGGCCCCAGCGGAGACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_022029 |
| Insert Size | 237 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC061102, AAH61102 |
| RefSeq Size | 1293 bp |
| RefSeq ORF | 237 bp |
| Locus ID | 64011 |
| UniProt ID | P60761 |
| Gene Summary | Regulates the affinity of calmodulin for calcium. Involved in synaptic plasticity and spatial learning.[UniProtKB/Swiss-Prot Function] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Neurogranin in the nucleus accumbens regulates NMDA receptor tolerance and motivation for ethanol seeking
,Reker, AN;Oliveros, A;Sullivan, JM;Nahar, L;Hinton, DJ;Kim, T;Bruner, RC;Choi, DS;Goeders, NE;Nam, HW;,
Neuropharmacology
,PubMed ID 29225043
[Nrgn]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200121 | Nrgn (tGFP-tagged) - Mouse neurogranin (Nrgn) |
CNY 3400.00 |
|
| MR200121 | Nrgn (Myc-DDK-tagged) - Mouse neurogranin (Nrgn) |
CNY 1800.00 |
|
| MR200121L3 | Lenti ORF clone of Nrgn (Myc-DDK-tagged) - Mouse neurogranin (Nrgn) |
CNY 5890.00 |
|
| MR200121L4 | Lenti ORF clone of Nrgn (mGFP-tagged) - Mouse neurogranin (Nrgn) |
CNY 5890.00 |

