Clec4e (NM_019948) Mouse Untagged Clone

CAT#: MC207531

Clec4e (untagged) - Mouse C-type lectin domain family 4, member e (Clec4e), (10ug)



  "NM_019948" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms C86253; Clecsf9; Mincle
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207531 representing NM_019948
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAATTCAACCAAATCGCCTGCATCCCACCACACAGAGAGAGGATGCTTCAAAAACTCCCAAGTGCTCT
CCTGGACGATAGCCGGGGCCTCCATCCTGTTTCTCAGTGGCTGTTTCATCACCAGATGTGTCGTAACATA
TCGCAGCTCTCAAATTTCCGGGCAGAACTTACAGCCACATAGAAATATTAAGGAGCTTTCCTGCTACAGT
GAGGCATCAGGTTCAGTCAAGAATTGCTGTCCTTTGAACTGGAAACATTATCAATCTAGTTGTTATTTTT
TCTCTACGACAACCTTGACCTGGTCATCAAGTTTAAAGAATTGCTCAGACATGGGGGCTCACCTGGTGGT
TATCGACACACAGGAAGAGCAGGAATTCCTTTTTCGCACAAAACCTAAAAGGAAAGAGTTTTATATTGGA
CTGACAGACCAGGTGGTGGAGGGTCAGTGGCAATGGGTGGATGATACACCTTTCACAGAGTCCCTGAGCT
TCTGGGATGCTGGGGAGCCCAACAATATAGTTTTGGTGGAGGACTGTGCCACCATAAGGGACTCTTCAAA
CTCCAGGAAGAACTGGAATGATATACCCTGTTTCTACAGTATGCCTTGGATTTGTGAGATGCCAGAAATA
AGTCCTCTGGACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_019948
Insert Size 645 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC003218, AAH03218
RefSeq Size 1606 bp
RefSeq ORF 645 bp
Locus ID 56619
UniProt ID Q9R0Q8
Gene Summary A calcium-dependent lectin that acts as a pattern recognition receptor of the innate immune system. Recognizes damage-associated molecular patterns (DAMPs) of abnormal self and pathogen-associated molecular patterns (PAMPs) of bacteria and fungi (PubMed:18509109, PubMed:19171887, PubMed:23602766, PubMed:18776906). The PAMPs notably include mycobacterial trehalose 6,6'-dimycolate (TDM), a cell wall glycolipid with potent adjuvant immunomodulatory functions (PubMed:23602766). Interacts with signaling adapter Fc receptor gamma chain/FCER1G to form a functional complex in myeloid cells (PubMed:23602766, PubMed:18776906). Binding of mycobacterial trehalose 6,6'-dimycolate (TDM) to this receptor complex leads to phosphorylation of the immunoreceptor tyrosine-based activation motif (ITAM) of FCER1G, triggering activation of SYK, CARD9 and NF-kappa-B, consequently driving maturation of antigen-presenting cells and shaping antigen-specific priming of T-cells toward effector T-helper 1 and T-helper 17 cell subtypes (PubMed:23602766). Specifically recognizes alpha-mannose residues on pathogenic fungi of the genus Malassezia and mediates macrophage activation (PubMed:19171887). Through recognition of DAMPs released upon nonhomeostatic cell death, enables immune sensing of damaged self and promotes inflammatory cell infiltration into the damaged tissue (PubMed:18776906).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...