Nupr1 (NM_019738) Mouse Untagged Clone

CAT#: MC207519

Nupr1 (untagged) - Mouse nuclear protein 1 (Nupr1), (10ug)



  "NM_019738" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2310032H04Rik; Com1; p8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207519 representing NM_019738
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCACCTTGCCACCAACAGCCAACCCTTCCCAGCAACCTCTAAACCTAGAGGATGAAGATGGAATCC
TGGATGAATATGATCAGTACAGCCTGGCCCATCCCTGTGTCGTCGGGGGAGGTCGGAAAGGTCGGACCAA
GAGAGAAGCTGCTGCCAATACCAACCGCCCTAGCCCTGGCGGGCATGAGAGGAAGCTGCTGACCAAGTTC
CAGAACTCTGAAAGGAAAAAAGCCTGGCGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_019738
Insert Size 243 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_019738.1, NP_062712.1
RefSeq Size 639 bp
RefSeq ORF 243 bp
Locus ID 56312
UniProt ID Q9WTK0
Gene Summary Transcription regulator that converts stress signals into a program of gene expression that empowers cells with resistance to the stress induced by a change in their microenvironment. Thereby participates in regulation of many process namely cell-cycle, apoptosis, autophagy and DNA repair responses (PubMed:11896600, PubMed:19723804, PubMed:23900510, PubMed:27451286, PubMed:22565310, PubMed:20181828). Controls cell cycle progression and protects cells from genotoxic stress induced by doxorubicin through the complex formation with TP53 and EP300 that binds CDKN1A promoter leading to transcriptional induction of CDKN1A (By similarity). Protects pancreatic cancer cells from stress-induced cell death by binding the RELB promoter and activating its transcription, leading to IER3 transactivation (PubMed:22565310). Negatively regulates apoptosis through interaction with PTMA (By similarity). Inhibits autophagy-induced apoptosis in cardiac cells through FOXO3 interaction, inducing cytoplasmic translocation of FOXO3 thereby preventing the FOXO3 association with the pro-autophagic BNIP3 promoter (PubMed:20181828). Inhibits cell growth and facilitates programmed cell death by apoptosis after adriamycin-induced DNA damage through transactivation of TP53 (PubMed:11896600). Regulates methamphetamine-induced apoptosis and autophagy through DDIT3-mediated endoplasmic reticulum stress pathway (By similarity). Participates to DNA repair following gamma-irradiation by facilitating DNA access of the transcription machinery through interaction with MSL1 leading to inhibition of histone H4' Lys-16' acetylation (H4K16ac) (By similarity). Coactivator of PAX2 transcription factor activity, both by recruiting the EP300 cofactor to increase PAX2 transcription factor activity and by binding PAXIP1 to suppress PAXIP1-induced inhibition on PAX2 (By similarity). Positively regulates cell cycle progression through interaction with COPS5 inducing cytoplasmic translocation of CDKN1B leading to the CDKN1B degradation (By similarity). Coordinates, through its interaction with EP300, the assiociation of MYOD1, EP300 and DDX5 to the MYOG promoter, leading to inhibition of cell-cycle progression and myogenic differentiation promotion (PubMed:19723804). Negatively regulates beta cell proliferation via inhibition of cell-cycle regulatory genes expression through the suppression of their promoter activities (PubMed:23900510). Also required for LHB expression and ovarian maturation (PubMed:18495683). Exacerbates CNS inflammation and demyelination upon cuprizone treatment (PubMed:16374777).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...